OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

UCHL5IP (HAUS7) (NM_017518) Human Untagged Clone

Be the first to review this product
SKU
SC322293
HAUS7 (untagged)-Human HAUS augmin-like complex, subunit 7 (HAUS7)
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA507060 HAUS7 mouse monoclonal antibody, clone OTI1E8 (formerly 1E8) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "UCHL5IP or NM_017518"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UCHL5IP
Synonyms UCHL5IP; UIP1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322293 GCTGGAGGTTGATTGGCGGTCTTGCCGGCCAGTGAAGCCAGGGCATGGGCGGGGCGCGGC
TCGGAGCGCGAAACATGGCGGGGCAGGACGCTGGCTGCGGCCGTGGCGGCGACGACTACT
CAGAGGACGAGGGCGACAGCAGCGTGTCCAGGGCGGCTGTGGAGGTGTTCGGGAAGCTGA
AGGACCTAAACTGCCCCTTCCTCGAGGGTCTGTATATCACAGAGCCAAAGACAATTCAGG
AACTGCTGTGCAGCCCCTCAGAGTACCGCTTGGAGATCCTAGAGTGGATGTGTACCCGGG
TCTGGCCCTCACTGCAGGACAGGTTCAGCTCACTGAAAGGGGTCCCAACAGAGGTGAAGA
TCCAAGAAATGACGAAGCTGGGCCACGAGCTGATGCTGTGTGCGCCAGATGACCAGGAGC
TCCTCAAGGGCTGTGCCTGCGCCCAGAAGCAGCTACACTTCATGGACCAGTTGCTCGATA
CCATCCGGAGCCTGACCATTGGGTGCTCCAGTTGCTCGAGCCTGATGGAGCACTTCGAGG
ACACCAGGGAGAAGAACGAGGCCTTGCTGGGGGAGCTCTTCTCTAGCCCCCACCTGCAGA
TGCTCCTGAATCCAGAGTGCGACCCGTGGCCCCTGGACATGCAGCCCCTCCTCAACAAGC
AGAGTGATGACTGGCAGTGGGCCAGTGCCTCTGCCAAGTCCGAGGAGGAGGAGAAGCTGG
CGGAGCTTGCCAGGCAGCTGCAGGAGAGTGCTGCCAAGTTGCACGCGCTTAGAACGGAGT
ACTTTGCACAGCATGAGCAAGGGGCTGCTGCGGGCGCAGCCGACATCAGCACCCTAGACC
AGAAGCTGCGTCTGGTCACTTCCGACTTCCACCAGCTAATCTTGGCTTTTCTCCAAGTCT
ACGACGACGAGCTGGGCGAGTGCTGCCAGCGCCCAGGCCCTGACCTCCACCCGTGCGGCC
CCATCATCCAGGCCACGCACCAGAATCTGACTTCCTACAGCCAACTGCTGCAAGTGGTCA
TGGCAGTTGCTGACACCTCTGCGAAGGCCGTGGAGACCGTGAAGAAGCAGCAAGGCGAGC
AGATCTGCTGGGGTGGCAGCAGCTCCGTCATGAGTCTAGCTACCAAGATGAATGAACTAA
TGGAGAAATAGAAAGTCTTCAGTGATGGCCTACGCCAAAGCACAGGATGGGGCGGGCAGG
AAGCCCTCTCCCAAGATCGAGTTGGCCGAGGATGGATGATTGTGGCAGCAGAAGCCGTTG
CAGCCCCACGTTGTGCTCTAGGCAGGGACCTTTGGCCCCTTTGGGGAGGGAGAGACAGAC
GGGCGGTTTGACTTGGACACAAAGAAAGCCTTGGTTTCTAAGCAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_017518
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_017518.5, NP_059988.3
RefSeq Size 1363 bp
RefSeq ORF 1107 bp
Locus ID 55559
UniProt ID Q99871
Cytogenetics Xq28
Summary This gene encodes a subunit of the augmin complex, which regulates centrosome and mitotic spindle integrity, and is necessary for the completion of cytokinesis. The encoded protein was identified by interaction with ubiquitin C-terminal hydrolase 37. Alternative splicing results in multiple transcript variants. provided by RefSeq, Sep 2012
Transcript Variant: This variant (1) encodes the protein. CCDS Note: The translation initiation codon selected for this CCDS representation has a strong Kozak signal, but it appears to be human-specific. A much better-conserved alternate start codon, which also has a strong Kozak signal, exists further downstream. Use of the downstream start codon would result in a protein that is 10 aa shorter at the N-terminus. No experimental evidence exists to indicate which start codon is used in vivo.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_017518" in other vectors (5)
SKU Description Size Price
RC203737 HAUS7 (Myc-DDK-tagged)-Human HAUS augmin-like complex, subunit 7 (HAUS7) 10 ug
$457.00
RC203737L3 Lenti ORF clone of Human HAUS augmin-like complex, subunit 7 (HAUS7), Myc-DDK-tagged 10 ug
$757.00
RC203737L4 Lenti ORF clone of Human HAUS augmin-like complex, subunit 7 (HAUS7), mGFP tagged 10 ug
$757.00
RG203737 HAUS7 (tGFP-tagged) - Human HAUS augmin-like complex, subunit 7 (HAUS7) 10 ug
$489.00 $657.00
SC114090 HAUS7 (untagged)-Human HAUS augmin-like complex, subunit 7 (HAUS7) 10 ug
$457.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products