OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TMEM106C (NM_024056) Human Untagged Clone

Be the first to review this product
SKU
SC322232
TMEM106C (untagged)-Human transmembrane protein 106C (TMEM106C), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA338645 Rabbit Polyclonal Anti-TMEM106C Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TMEM106C or NM_024056"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TMEM106C
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322232 GACATGACACCAGTGGCATATCACGGCCATGGGGTCTCAGCATTCCGCTGCTGCTCGCCC
CTCCTCCTGCAGGCGAAAGCAAGAAGATGACAGGGACGGTTTGCTGGCTGAACGAGAGCA
GGAAGAAGCCATTGCTCAGTTCCCATATGTGGAATTCACCGGGAGAGATAGCATCACCTG
TCTCACGTGCCAGGGGACAGGCTACATTCCAACAGAGCAAGTAAATGAGTTGGTGGCTTT
GATCCCACACAGTGATCAGAGATTGCGCCCTCAGCGAACTAAGCAATATGTCCTCCTGTC
CATCCTGCTTTGTCTCCTGGCATCTGGTTTGGTGGTTTTCTTCCTGTTTCCGCATTCAGT
CCTTGTGGATGATGACGGCATCAAAGTGGTGAAAGTCACATTTAATAAGCAAGACTCCCT
TGTAATTCTCACCATCATGGCCACCCTGAAAATCAGGAACTCCAACTTCTACACGGTGGC
AGTGACCAGCCTGTCCAGCCAGATTCAGTACATGAACACAGTGGTCAGTACATATGTGAC
TACTAACGTCTCCCTTATTCCACCTCGGAGTGAGCAACTGGTGAATTTTACCGGGAAGGC
CGAGATGGGAGGACCGTTTTCCTATGTGTACTTCTTCTGCACGGTACCTGAGATCCTGGT
GCACAACATAGTGATCTTCATGCGAACTTCAGTGAAGATTTCATACATTGGCCTCATGAC
CCAGAGCTCCTTGGAGACACATCACTATGTGGATTGTGGAGGAAATTCCACAGCTATTTA
ACAACTGCTATTGGTTCTTCCACACAGCGCCTGTAGAAGAGAGCACAGCATATGTTCCCA
AGGCCTGAGTTCTGGACCTACCCCCACGTGGTGTAAGCAGAGGAGGAATTGGTTCACTTA
ACTCCCAGCAAACATCCTCCTGCCACTTAGGAGGAAACACCTCCCTATGGTACCATTTAT
GTTTCTCAGAACCAGCAGAATCAGTGCCTAGCCTGTGCCCAGCAAATAGTTGGCACTCAA
TAAAGATTTGCAGAATTTAATACAGATCTTTTCAGCTGTTCTTAGGGCATTATAAATGGA
AATCATAACGTGGTTCTAGGTTATCAAACCATGGAGTGATGTGGAGCTAGGATTGTGAGT
GACCTGCAGGCCATTATCAGTGCCTCATCTGTGCAGAAGTGGCAGCAGAGAGGGACCATC
CAAATACCTAAGAGAAAACAGACCTAGTCAGGATATGAATTTGTTTCAGCTGTTCCCAAA
GGCCTGGGAGCTTTTTGAAAAGAAAGAAAAAAGTGTGTTGGCTTTTTTTTTTTTTTAGAA
AGTTAGAATTGTTTTTACCAAGAGTCTATGTGGGGCTTGATTCACCCTTCATCCATTGGC
TGGAACATGGATTGGGGATTTGATAGAAAAATAAACCCTGCTTTTGATTCAAAAAAAAAA
AAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_024056
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024056.2, NP_076961.1
RefSeq Size 1449 bp
RefSeq ORF 753 bp
Locus ID 79022
UniProt ID Q9BVX2
Cytogenetics 12q13.11
Protein Families Transmembrane
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_024056" in other vectors (5)
SKU Description Size Price
RC201718 TMEM106C (Myc-DDK-tagged)-Human transmembrane protein 106C (TMEM106C), transcript variant 2 10 ug
$300.00
RC201718L3 Lenti ORF clone of Human transmembrane protein 106C (TMEM106C), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC201718L4 Lenti ORF clone of Human transmembrane protein 106C (TMEM106C), transcript variant 2, mGFP tagged 10 ug
$600.00
RG201718 TMEM106C (tGFP-tagged) - Human transmembrane protein 106C (TMEM106C), transcript variant 2 10 ug
$489.00 $500.00
SC107982 TMEM106C (untagged)-Human transmembrane protein 106C (TMEM106C), transcript variant 2 10 ug
$300.00

file-alt Citations

Lysosome size, motility and stress response regulated by fronto-temporal dementia modifier TMEM106B
Stagi, Klein, Gould et al
Mol. Cell. Neurosci. (2014)
Cited by 139
AI Summary: OriGene products contributed full-length human TMEM106B–WT, TMEM106B–T185S, mouse TMEM106B, and human TMEM106C cDNA plasmids, which were used as templates to generate various expression constructs for functional studies in this paper.
Snippet: TMEM106B expression vectors under the chicken beta actin promoter were generated by amplifying the coding sequence of human TMEM106B–WT or TMEM106B–T185S full-length cDNAs (Origene, for both sequences) and cloning into the pCAGG vector via EcoRI sites. From pCAGG–human–TMEM106B–WT or T185S, a Cherry fluorescent protein tag was sub-cloned in frame immediately before the stop codon of TMEM via SmaI to obtain pCAGG–hTMEM106B–Cherry with WT or T185S. From pCAGG–human–TMEM106b, a pHlourin fluorescent protein tag was sub-cloned in frame to the carboxyl terminal of TMEM via SmaI to obtain pCAGG–hTMEM106B–pHlourin. Mouse TMEM106B was amplified from a full-length cDNA plasmid (Origene) and sub-cloned in frame into pCAGG–Cherry to obtain pCAGG–mTMEM106B–Cherry. Human TMEM106C was amplified from a full-length cDNA plasmid (Origene) and sub-cloned in frame into pCAGG–eGFP to obtain pCAGGS–hTMEM106C–eGFP. …
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products