OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PPP1R7 (NM_002712) Human Untagged Clone

Be the first to review this product
SKU
SC322184
PPP1R7 (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7)
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA500614 PPP1R7 mouse monoclonal antibody, clone OTI4F9 (formerly 4F9) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PPP1R7 or NM_002712"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PPP1R7
Synonyms SDS22
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322184 GAGCAGCCAACATGGCGGCGGAACGCGGCGCGGGGCAGCAACAGTCGCAGGAGATGATGG
AGGTTGACAGGCGGGTCGAGTCTGAAGAATCCGGCGATGAAGAAGGGAAGAAACACAGCA
GTGGCATCGTGGCCGACCTCAGTGAACAGAGCCTGAAGGATGGGGAGGAGCGGGGGGAGG
AGGACCCAGAAGAAGAACATGAGCTGCCTGTGGACATGGAAACCATCAACCTGGACAGAG
ATGCAGAGGATGTTGATTTGAATCACTATCGCATAGGGAAGATTGAAGGATTTGAGGTAC
TGAAGAAAGTGAAGACTCTCTGCCTCCGCCAAAATTTAATTAAATGCATTGAGAATCTGG
AGGAGCTACAGAGTCTTCGAGAGCTGGATCTTTACGACAACCAGATCAAGAAGATTGAGA
ATCTGGAGGCGCTAACAGAGCTGGAGATTCTAGATATTTCTTTTAATCTGCTGAGAAACA
TCGAAGGGGTTGACAAGTTGACACGACTGAAAAAACTCTTCTTGGTCAACAATAAAATCA
GTAAAATTGAGAACTTAAGCAACTTACATCAACTACAGATGCTAGAGCTGGGATCTAACC
GCATCCGGGCAATCGAAAATATCGACACCTTAACCAACCTGGAGAGTTTGTTTTTGGGGA
AAAACAAAATTACTAAACTTCAGAACCTGGATGCGCTCACCAACCTGACAGTCCTCAGTA
TGCAGAGCAACCGGCTGACCAAGATCGAGGGTCTGCAGAACCTGGTGAACCTGCGGGAGC
TGTACCTTAGCCACAATGGCATCGAGGTCATCGAGGGCCTGGAGAACAATAACAAACTCA
CGATGTTGGACATTGCATCAAATAGAATCAAAAAGATTGAAAATATCAGCCATCTAACAG
AGCTGCAAGAGTTCTGGATGAACGACAATCTCCTTGAGAGCTGGAGCGACCTCGACGAGC
TGAAGGGAGCCAGGAGCCTGGAGACAGTGTACCTGGAGCGGAACCCCTTGCAGAAGGACC
CCCAGTACCGGCGGAAGGTCATGCTCGCCCTCCCCTCCGTGCGGCAGATCGATGCCACGT
TCGTCAGGTTCTGAGTCCTTCTTGGCTCCTCATGTGGTCCCTCTCCTCGGAAGAACTGCC
CAGCCACGGGTTTTTAACCCACCTGTTGCTCCTGAGGTCGTCACTATATCAACAGTCACA
AACCCAATGGCAATAAAGGCACTGACGATAGCTGGCGCGCGTGACGCCACACACCATTTT
CAGATGCCGTTGCAATTAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_002712
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002712.1, NP_002703.1
RefSeq Size 1299 bp
RefSeq ORF 1083 bp
Locus ID 5510
UniProt ID Q15435
Cytogenetics 2q37.3
Domains LRR, LRRcap, LRR_SD22, LRR_TYP
Protein Families Druggable Genome, Phosphatase
Summary This gene encodes a protein subunit that regulates the activity of the serine/threonine phosphatase, protein phosphatase-1. The encoded protein is required for completion of the mitotic cycle and for targeting protein phosphatase-1 to mitotic kinetochores. Alternate splicing results in multiple transcript variants. provided by RefSeq, Sep 2013
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1, also known as sds22alpha1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002712" in other vectors (7)
SKU Description Size Price
RC201634 PPP1R7 (Myc-DDK-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7) 10 ug
$457.00
RC201634L1 Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7), Myc-DDK-tagged 10 ug
$757.00
RC201634L2 Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7), mGFP tagged 10 ug
$757.00
RC201634L3 Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7), Myc-DDK-tagged 10 ug
$757.00
RC201634L4 Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7), mGFP tagged 10 ug
$757.00
RG201634 PPP1R7 (tGFP-tagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7) 10 ug
$489.00 $657.00
SC108479 PPP1R7 (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 7 (PPP1R7) 10 ug
$457.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products