OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MRRF (NM_199177) Human Untagged Clone

Be the first to review this product
SKU
SC322027
MRRF (untagged)-Human mitochondrial ribosome recycling factor (MRRF), nuclear gene encoding mitochondrial protein, transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA805997 MRRF mouse monoclonal antibody, clone OTI1D5 (formerly 1D5) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MRRF or NM_199177"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MRRF
Synonyms MRFF; MTRRF; RRF
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322027 GATGTTTCCAAGGATTGTCTTCAGTCATGGCCTTGGGATTAAAGTGCTTCCGCATGGTCC
ACCCTACCTTTCGCAATTATCTTGCAGCCTCTATCAGACCCGTTTCAGAAGTTACACTGA
AGACAGTGCATGAAAGACAACATGGCCATAGGCAATACATGGCCTATTCAGCTGTACCAG
TCCGCCATTTTGCTACCAAGAAAGCCAAAGCCAAAGGGAAAGGACAGTCCCAAACCAGAG
TGAATATTAATGCTGCCTTGGTTGAGGATATAATCAACTTGGAAGAGGTGAATGAAGAAA
TGAAGTCTGTGATAGAAGCTCTCAAGGATAATTTCAATAAGACTCTCAATATAAGGACCT
CACCAGGATCCCTTGACAAGATTGCTGTGGTAACTGCTGACGGGAAGCTTGCTTTAAACC
AGATTAGCCAGATCTCCATGAAGTCGCCACAGCTGATTTTGGTGAATATGGCCAGCTTCC
CAGAGTGTACAGCTGCAGCTATCAAGGCTATAAGAGAAAGTGGAATGAATCTGAACCCAG
AAGTGGAAGGGACGCTAATTCGGGTACCCATTCCCCAATCAGCCAAATGGCCGATGACAC
AGTGGCAGAACTGGACAGGCATCTGGCAGTGAAGACCAAAGAACTCCTTGGATGAAAGTC
CACTGGGGCCAGCAATACTCCAGAGCCCAGTTTCTGCTGGATCCCATGGGTGGCACATTG
GGACTTCTCTCCCTCCCCCATCTACACAGAAGACTGTCACCATGCTGACAGAAGCCTGTC
CTTGTAAGGCCCAGCCTTCCAGGGGAACACTCAGACATGTTCATTCTCTTCCTGCTTCTG
CTCTGGGCCGGTGGGTGGCTCTCAGAAAATACTTGCTGCTGGCAAAAGGCCTGTACTCAG
GCATTTGCTTTGACTTGATGTTGCCAAGGGACTGAGGCCATTGGCAGGCTTAGTACCACC
TGCTCCTCATCTTAGGAGTCTCCTTTTCAAATAATTAGGCTCTGTTCCCATTTTAAAACT
CTGATATTGGCCTTCACCTGTGACTGGACACTTTACTAGAGGCCCATTTTCACTAAACAA
TAAAATCTAAATAAATTGGAAGGAATAACAACCACAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_199177
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199177.1, NP_954646.1
RefSeq Size 1627 bp
RefSeq ORF 606 bp
Locus ID 92399
UniProt ID Q96E11
Cytogenetics 9q33.2
Protein Families Transmembrane
Summary This gene encodes a ribosome recycling factor, which is a component of the mitochondrial translational machinery. The encoded protein, along with mitochondrial elongation factor 2, functions in ribosomal recycling at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA. A pseudogene of this gene has been identified on chromosome X. provided by RefSeq, Oct 2016
Transcript Variant: This variant (2) lacks an exon in the 3' coding region resulting in a frameshift, compared to isoform 1. The sequence of the 5' UTR of this variant has not been determined. The resulting isoform (2) has a shorter and distinct C-terminu
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_199177" in other vectors (4)
SKU Description Size Price
RC208798 MRRF (Myc-DDK-tagged)-Human mitochondrial ribosome recycling factor (MRRF), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$300.00
RC208798L3 Lenti ORF clone of Human mitochondrial ribosome recycling factor (MRRF), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC208798L4 Lenti ORF clone of Human mitochondrial ribosome recycling factor (MRRF), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged 10 ug
$600.00
RG208798 MRRF (tGFP-tagged) - Human mitochondrial ribosome recycling factor (MRRF), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products