OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CD38 (NM_001775) Human Untagged Clone

Be the first to review this product
SKU
SC321273
CD38 (untagged)-Human CD38 molecule (CD38)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA804538 CD38 mouse monoclonal antibody,clone OTI1C9 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CD38 or NM_001775"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CD38
Synonyms ADPRC 1; ADPRC1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001775.2 GCCTCCTGCCGGCCTCATCTTCGCCCAGCCAACCCCGCCTGGAGCCCTATGGCCAACTGC
GAGTTCAGCCCGGTGTCCGGGGACAAACCCTGCTGCCGGCTCTCTAGGAGAGCCCAACTC
TGTCTTGGCGTCAGTATCCTGGTCCTGATCCTCGTCGTGGTGCTCGCGGTGGTCGTCCCG
AGGTGGCGCCAGCAGTGGAGCGGTCCGGGCACCACCAAGCGCTTTCCCGAGACCGTCCTG
GCGCGATGCGTCAAGTACACTGAAATTCATCCTGAGATGAGACATGTAGACTGCCAAAGT
GTATGGGATGCTTTCAAGGGTGCATTTATTTCAAAACATCCTTGCAACATTACTGAAGAA
GACTATCAGCCACTAATGAAGTTGGGAACTCAGACCGTACCTTGCAACAAGATTCTTCTT
TGGAGCAGAATAAAAGATCTGGCCCATCAGTTCACACAGGTCCAGCGGGACATGTTCACC
CTGGAGGACACGCTGCTAGGCTACCTTGCTGATGACCTCACATGGTGTGGTGAATTCAAC
ACTTCCAAAATAAACTATCAATCTTGCCCAGACTGGAGAAAGGACTGCAGCAACAACCCT
GTTTCAGTATTCTGGAAAACGGTTTCCCGCAGGTTTGCAGAAGCTGCCTGTGATGTGGTC
CATGTGATGCTCAATGGATCCCGCAGTAAAATCTTTGACAAAAACAGCACTTTTGGGAGT
GTGGAAGTCCATAATTTGCAACCAGAGAAGGTTCAGACACTAGAGGCCTGGGTGATACAT
GGTGGAAGAGAAGATTCCAGAGACTTATGCCAGGATCCCACCATAAAAGAGCTGGAATCG
ATTATAAGCAAAAGGAATATTCAATTTTCCTGCAAGAATATCTACAGACCTGACAAGTTT
CTTCAGTGTGTGAAAAATCCTGAGGATTCATCTTGCACATCTGAGATCTGAGCCAGTCGC
TGTGGTTGTTTTAGCTCCTTGACTCCTTGTGGTTTATGTCATCATACATGACTCAGCATA
CCTGCTGGTGCAGAGCTGAAGATTTTGGAGGGTCCTCCACAATAAGGTCAATGCCAGAGA
CGGAAGCCTTTTTCCCCAAAGTCTTAAAATAACTTATATCATCAGCATACCTTTATTGTG
ATCTATCAATAGTCAAGAAAAATTATTGTATAAGATTAGAATGAAAATTGTATGTTAAGT
TACTTCAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_001775
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001775.2, NP_001766.2
RefSeq Size 1494 bp
RefSeq ORF 903 bp
Locus ID 952
UniProt ID P28907
Cytogenetics 4p15.32
Domains Rib_hydrolayse
Protein Families Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transmembrane
Protein Pathways Calcium signaling pathway, Hematopoietic cell lineage, Metabolic pathways, Nicotinate and nicotinamide metabolism
Summary The protein encoded by this gene is a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Crystal structure analysis demonstrates that the functional molecule is a dimer, with the central portion containing the catalytic site. It is used as a prognostic marker for patients with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. provided by RefSeq, Sep 2015
Transcript Variant: This variant (1) represents the longer transcript and encodes the protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001775" in other vectors (6)
SKU Description Size Price
RC203179 CD38 (Myc-DDK-tagged)-Human CD38 molecule (CD38) 10 ug
$450.00
RC203179L1 Lenti ORF clone of Human CD38 molecule (CD38), Myc-DDK-tagged 10 ug
$750.00
RC203179L2 Lenti ORF clone of Human CD38 molecule (CD38), mGFP tagged 10 ug
$750.00
RC203179L3 Lenti ORF clone of Human CD38 molecule (CD38), Myc-DDK-tagged 10 ug
$750.00
RC203179L4 Lenti ORF clone of Human CD38 molecule (CD38), mGFP tagged 10 ug
$750.00
RG203179 CD38 (tGFP-tagged) - Human CD38 molecule (CD38) 10 ug
$489.00 $650.00

file-alt Citations

Activation of neurotensin receptor 1 facilitates neuronal excitability and spatial learning and memory in the entorhinal cortex: beneficial actions in an Alzheimer's disease model
Xiao, Cilz, Kurada et al
J. Neurosci. (2014) 34 (20), 7027-42 DOI: 10.1523/JNEUROSCI.0408-14.2014
AI Summary: OriGene provided the TREK-2 cDNA construct (NM_021161, subcloned into the pCMV6-XL4 vector), which was used to study the molecular mechanisms by which neurotensin modulates neuronal excitability in the entorhinal cortex.
Snippet: cDNA constructs coding for TREK-2 (NM_021161, subcloned into the pCMV6-XL4 vector) were purchased from Origene. An empty pEGFP N-3 GFP fusion protein vector (GenBank accession number U57609) was purchased from Clontech. ... Cite SaveSaving
Die Bedeutung der zellulären Volumenregulation bei der Kryo-Arretierung biologischer Systeme
Christmann
Thesis (2013)
Snippet: CD38 wurde als Volllängen-Klon von OriGENE (OriGENE Technologies, Maryland, USA) bezogen und über eine mit Primern eingebrachte SacI und SalI Schnittstelle in eine mKate2-C1 Expressionsvektor kloniert, so dass ein N-Terminal fusioniertes Konstrukt entstand
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products