OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SEC61G (NM_014302) Human Untagged Clone

Be the first to review this product
SKU
SC321165
SEC61G (untagged)-Human Sec61 gamma subunit (SEC61G), transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA309003 Rabbit polyclonal antibody to Sec61 gamma subunit (Sec61 gamma subunit)
100 ul
$665.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SEC61G or NM_014302"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SEC61G
Synonyms SSS1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_014302.3 GGCACGAGGCTGGCATTTTAGGTGTCGGTTGGGTAGGCAGTCATGGATCAGGTAATGCAG
TTTGTTGAGCCAAGTCGGCAGTTTGTAAAGGACTCCATTCGGCTGGTTAAAAGATGCACT
AAACCTGATAGAAAAGAATTCCAGAAGATTGCCATGGCAACAGCAATAGGATTTGCTATA
ATGGGATTCATTGGCTTCTTTGTGAAATTGATCCATATTCCTATTAATAACATCATTGTT
GGTGGCTGAATACATTTTGGAAGAGAGTTTTTCATCTTAGAGATTGGTGAACAAGTGTGA
GGGTGTGAGAAACTCACAGAATACAAATTTGCCTGTATGTTTTGTGGGTTTTTTTTTTCC
TTTCAAGATGTTTTCTATTTCTAAATTAAAGTAATTTCAAAGTAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_014302
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014302.3, NP_055117.1
RefSeq Size 484 bp
RefSeq ORF 207 bp
Locus ID 23480
UniProt ID P60059
Cytogenetics 7p11.2
Domains SecE
Protein Families Transmembrane
Protein Pathways Vibrio cholerae infection
Summary The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. Oligomers of the Sec61 complex form a transmembrane channel where proteins are translocated across and integrated into the ER membrane. This complex consists of three membrane proteins- alpha, beta, and gamma. This gene encodes the gamma-subunit protein. Alternatively spliced transcript variants encoding the same protein have been identified. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_014302" in other vectors (6)
SKU Description Size Price
RC203481 SEC61G (Myc-DDK-tagged)-Human Sec61 gamma subunit (SEC61G), transcript variant 1 10 ug
$150.00
RC203481L1 Lenti ORF clone of Human Sec61 gamma subunit (SEC61G), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC203481L2 Lenti ORF clone of Human Sec61 gamma subunit (SEC61G), transcript variant 1, mGFP tagged 10 ug
$450.00
RC203481L3 Lenti ORF clone of Human Sec61 gamma subunit (SEC61G), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC203481L4 Lenti ORF clone of Human Sec61 gamma subunit (SEC61G), transcript variant 1, mGFP tagged 10 ug
$450.00
RG203481 SEC61G (tGFP-tagged) - Human Sec61 gamma subunit (SEC61G), transcript variant 1 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products