OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CEP27 (HAUS2) (NM_018097) Human Untagged Clone

Be the first to review this product
SKU
SC320878
HAUS2 (untagged)-Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA372224 HAUS2 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CEP27 or NM_018097"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CEP27
Synonyms C15orf25; CEP27; HsT17025
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_018097.1 GGGGACTCTTGGCGCCTTCGCGGAAGGTGCGTCCGAGCCATGGCCGCTGCCAACCCGTGG
GACCCGGCGTCCGCGCCTAACGGCGCTGGGCTAGTGCTAGGCCACTTCATAGCTTCGGGG
ATGGTCAATCAGGAGATGTTAAACATGTCTAAGAAAACAGTTTCTTGTTTTGTGAACTTC
ACCAGACTACAGCAGATCACAAATATTCAAGCTGAAATCTACCAGAAAAACCTGGAAATT
GAACTCCTGAAACTAGAAAAAGATACAGCAGATGTTGTTCATCCTTTCTTTTTGGCTCAG
AAGTGTCATACTCTGCAAAGCATGAATAATCATTTGGAAGCAGTGCTGAAAGAGAAGAGA
TCCCTTAGGCAAAGACTGTTGAAACCCATGTGCCAGGAAAACTTACCTATTGAAGCTGTT
TATCACAGATATATGGTACATTTGCTGGAGTTGGCTGTGACTTTCATTGAGAGATTAGAA
ACCCACCTTGAAACAATTAGAAATATTCCTCATTTAGCTGCAAATCTAAAGAAAATGAAC
CAGGCTTTAGCAAAGATGGATATATTGGTGACTGAGACAGAAGAACTGGCAGAGAATATA
CTCAAGTGGCGTAAACAACAAAACGAAGTTTCGTCTTGTATCCCCAAAATATTAGCTGAA
GAAAGTTATCTTTATAAACATGATATTATAATGCCTCCTTTACCTTTTACTTCTAAAGTT
CATGTCCAAACTATTAATGCCAAGTAGTCATCAACTTTATTTTTGCTTAATTATGTGTAG
TCATATGAAGTCTATTTCTAGTTGACTGTAACATGGGTATTAATAGTCTTTGCTGCTGGT
AATACTGAAAGAACCTGCTTTATATTGGAGTATCAAGATCTCAGGTTCATTAAGACCAAA
CTGACTTTTCCTTTGTTTTTCATATATTTTTATTCTACCTTTCAGTAAAACTAGAGAAGC
TAAAAAAAGAGCCATGACAATTTATTAATATAAGTGAATTAACCATTTCTCAGGTGGGAA
ATTCTCTTTTTTTAAAAATGTGTGTTTATCGTCTGGTGTGGTGGCTCACACCTGTAATCC
TAACACTTGGGGAGGCTGAGGCGGGCAGATCACTTGAACCCAGGAGTTCAAGACCAGCCT
GGGTAACATGGTGAAATCCCATATCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_018097
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018097.1, NP_060567.1
RefSeq Size 1754 bp
RefSeq ORF 708 bp
Locus ID 55142
UniProt ID Q9NVX0
Cytogenetics 15q15.2
Summary The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. provided by RefSeq, Apr 2016
Transcript Variant: This variant (1) represents the longer transcript and it encodes the longer protein (isoform 1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_018097" in other vectors (5)
SKU Description Size Price
RC203071 HAUS2 (Myc-DDK-tagged)-Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 1 10 ug
$450.00
RC203071L3 Lenti ORF clone of Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC203071L4 Lenti ORF clone of Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 1, mGFP tagged 10 ug
$750.00
RG203071 HAUS2 (tGFP-tagged) - Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 1 10 ug
$650.00
SC127097 HAUS2 (untagged)-Human HAUS augmin-like complex, subunit 2 (HAUS2), transcript variant 1 10 ug
$300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products