OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TTC32 (NM_001008237) Human Untagged Clone

Be the first to review this product
SKU
SC320116
TTC32 (untagged)-Human tetratricopeptide repeat domain 32 (TTC32)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA501337 Anti-TTC32 mouse monoclonal antibody, clone OTI1F7 (formerly 1F7) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TTC32 or NM_001008237"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TTC32
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001008237.1 ATGAGGCACAAACCTAGCGCCAAGGTTGGCTGTCAAGGTAGATTCCAGGGTGTGGAAGTG
GCTTTGTGGTGCCACCTCTAACCGCTCGGAGGTCAACCCCCATTCTACACCGAAAACTAG
GCCTTGGCTGCTATGGAAGGACAGCGGCAAGAAAGCCACGCAACCCTAACACTCGCCCAG
GCTCATTTCAACAATGGAGAGTACGCGGAGGCCGAGGCACTGTACTCCGCTTACATTCGC
CGGTGCGCTTGCGCGGCCTCCAGCGACGAGAGTCCCGGGAGCAAATGCAGCCCTGAGGAT
TTGGCTACTGCATATAACAACAGGGGGCAAATCAAGTACTTCAGGGTTGATTTTTATGAA
GCCATGGATGACTACACATCTGCCATAGAAGTCCAACCCAATTTTGAAGTTCCATATTAC
AACAGAGGGTTGATACTGTATAGGCTGGGATATTTTGATGATGCTTTGGAAGATTTCAAG
AAGGTCTTAGACTTAAATCCTGGATTTCAAGATGCTACTTTGAGCTTAAAACAGACTATT
CTAGACAAAGAAGAAAAACAAAGAAGAAATGTTGCAAAAAATTATTGATATTTTTAACTT
AATGGAAGTATTGATTCATGGTCCTTACATCTGCATCTAGTTATCAGTAATTTAGATATT
GAGCTATTTTGATTTATATTTAAGAAATTAATACATTAGCACTGAAAGTTAAATAGTGTG
TTTAAGGTAGTTAATTTCAGGTTGAATGGGTTTTTTTTAATGAAGTGTAAATAATACCAA
TGTATAAGTGTATATTATTATATTAAATATTATAGTAAAAAGAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_001008237
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001008237.1, NP_001008238.1
RefSeq Size 838 bp
RefSeq ORF 456 bp
Locus ID 130502
UniProt ID Q5I0X7
Cytogenetics 2p24.1
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001008237" in other vectors (4)
SKU Description Size Price
RC209334 TTC32 (Myc-DDK-tagged)-Human tetratricopeptide repeat domain 32 (TTC32) 10 ug
$150.00
RC209334L3 Lenti ORF clone of Human tetratricopeptide repeat domain 32 (TTC32), Myc-DDK-tagged 10 ug
$450.00
RC209334L4 Lenti ORF clone of Human tetratricopeptide repeat domain 32 (TTC32), mGFP tagged 10 ug
$450.00
RG209334 TTC32 (tGFP-tagged) - Human tetratricopeptide repeat domain 32 (TTC32) 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products