OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SUSD4 (NM_017982) Human Untagged Clone

Be the first to review this product
SKU
SC317818
SUSD4 (untagged)-Human sushi domain containing 4 (SUSD4), transcript variant 1
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA342349 Rabbit Polyclonal Anti-SUSD4 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SUSD4 or NM_017982"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SUSD4
Synonyms PRO222
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317818 representing NM_017982.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTATCATGGAATGAACCCGAGCAATGGAGATGGATTTCTAGAGCAGCAGCAGCAGCAGCAGCAACCT
CAGTCCCCCCAGAGACTCTTGGCCGTGATCCTGTGGTTTCAGCTGGCGCTGTGCTTCGGCCCTGCACAG
CTCACGGGCGGGTTCGATGACCTTCAAGTGTGTGCTGACCCCGGCATTCCCGAGAATGGCTTCAGGACC
CCCAGCGGAGGGGTTTTCTTTGAAGGCTCTGTAGCCCGATTTCACTGCCAAGACGGATTCAAGCTGAAG
GGCGCTACAAAGAGACTGTGTTTGAAGCATTTTAATGGAACCCTAGGCTGGATCCCAAGTGATAATTCC
ATCTGTGTGCAAGAAGATTGCCGTATCCCTCAAATCGAAGATGCTGAGATTCATAACAAGACATATAGA
CATGGAGAGAAGCTAATCATCACTTGTCATGAAGGATTCAAGATCCGGTACCCCGACCTACACAATATG
GTTTCATTATGTCGCGATGATGGAACGTGGAATAATCTGCCCATCTGTCAAGGCTGCCTGAGACCTCTA
GCCTCTTCTAATGGCTATGTAAACATCTCTGAGCTCCAGACCTCCTTCCCGGTGGGGACTGTGATCTCC
TATCGCTGCTTTCCCGGATTTAAACTTGATGGGTCTGCGTATCTTGAGTGCTTACAAAACCTTATCTGG
TCGTCCAGCCCACCCCGGTGCCTTGCTCTGGAAGTCTGTCCACTACCTCCAATGGTGAGTCACGGAGAT
TTCGTCTGCCACCCGCGGCCTTGTGAGCGCTACAACCACGGAACTGTGGTGGAGTTTTACTGCGATCCT
GGCTACAGCCTCACCAGCGACTACAAGTACATCACCTGCCAGTATGGAGAGTGGTTTCCTTCTTATCAA
GTCTACTGCATCAAATCAGAGCAAACGTGGCCCAGCACCCATGAGACCCTCCTGACCACGTGGAAGATT
GTGGCGTTCACGGCAACCAGTGTGCTGCTGGTGCTGCTGCTCGTCATCCTGGCCAGGATGTTCCAGACC
AAGTTCAAGGCCCACTTTCCCCCCAGGGGGCCTCCCCGGAGTTCCAGCAGTGACCCTGACTTTGTGGTG
GTAGACGGCGTGCCCGTCATGCTCCCGTCCTATGACGAAGCTGTGAGTGGCGGCTTGAGTGCCTTAGGC
CCCGGGTACATGGCCTCTGTGGGCCAGGGCTGCCCCTTACCCGTGGACGACCAGAGCCCCCCAGCATAC
CCCGGCTCAGGGGACACGGACACAGGCCCAGGGGAGTCAGAAACCTGTGACAGCGTCTCAGGCTCTTCT
GAGCTGCTCCAAAGTCTGTATTCACCTCCCAGGTGCCAAGAGAGCACCCACCCTGCTTCGGACAACCCT
GACATAATTGCCAGCACGGCAGAGGAGGTGGCATCCACCAGCCCAGGCATCGACATTGCAGATGAGATT
CCTCTAATGGAAGAAGATCCCTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_017982
Insert Size 1473 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_017982.3
RefSeq Size 3030 bp
RefSeq ORF 1473 bp
Locus ID 55061
UniProt ID Q5VX71
Cytogenetics 1q41
Domains CCP
Protein Families Transmembrane
MW 53.8 kDa
Summary Acts as complement inhibitor by disrupting the formation of the classical C3 convertase. Isoform 3 inhibits the classical complement pathway, while membrane-bound isoform 1 inhibits deposition of C3b via both the classical and alternative complement pathways.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_017982" in other vectors (7)
SKU Description Size Price
RC222946 SUSD4 (Myc-DDK-tagged)-Human sushi domain containing 4 (SUSD4), transcript variant 1 10 ug
$457.00
RC222946L1 Lenti ORF clone of Human sushi domain containing 4 (SUSD4), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC222946L2 Lenti ORF clone of Human sushi domain containing 4 (SUSD4), transcript variant 1, mGFP tagged 10 ug
$757.00
RC222946L3 Lenti ORF clone of Human sushi domain containing 4 (SUSD4), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC222946L4 Lenti ORF clone of Human sushi domain containing 4 (SUSD4), transcript variant 1, mGFP tagged 10 ug
$757.00
RG222946 SUSD4 (tGFP-tagged) - Human sushi domain containing 4 (SUSD4), transcript variant 1 10 ug
$489.00 $657.00
SC113830 SUSD4 (untagged)-Human sushi domain containing 4 (SUSD4), transcript variant 1 10 ug
$300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products