OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

FAM181A (NM_138344) Human Untagged Clone

Be the first to review this product
SKU
SC317560
FAM181A (untagged)-Human family with sequence similarity 181, member A (FAM181A), transcript variant 1
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "FAM181A or NM_138344"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FAM181A
Synonyms C14orf152
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317560 representing NM_138344.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCTTAGAAGAGAGAAGATCTTCTGGAGAGAGGAATGATGCAGCCCCCACAAATCACAGAAGGCCT
GGGGAGAAAAGGGCGAGCACAGCAAAGCAGGTCAGCTCGGTGCCCTTCCTTGGAGCTGCCGGCCACCAG
CAGAGCCTACCCTCTTCATGGAAAGCCTCGTGCAGTGGCCCCCTGGTGATGGCATCCGACAGTGATGTG
AAGATGCTGCTGAACTTCGTGAACCTGGCGTCCAGCGACATCAAGGCAGCCCTGGATAAGTCCGCACCC
TGCCGCCGCTCCGTGGACCATCGCAAGTACCTGCAGAAGCAGCTCAAGCGCTTCTCCCAGAAGTATTCC
CGGCTCCCGCGGGGCCTTCCTGGCAGAGCTGCTGAGCCCTACCTGAAAAGGGGGTCTGAGGACCGGCCC
AGGAGGCTGCTCCTGGATTTGGGCCCTGATTCCAGCCCCGGCGGGGGTGGGGGCTGCAAGGAGAAGGTG
CTGAGGAACCCCTACAGGGAGGAATGTCTTGCTAAGGAGCAGCTCCCACAGAGGCAGCATCCAGAAGCT
GCCCAGCCTGGCCAGGTGCCCATGAGGAAAAGACAGCTGCCCGCTTCCTTCTGGGAAGAGCCAAGGCCC
ACCCACAGCTACCATGTGGGGCTGGAGGGGGGACTGGGCCCCAGGGAGGGACCTCCCTATGAGGGTAAG
AAAAATTGCAAGGGCTTGGAGCCCCTGGGACCTGAGACTACCCTGGTGTCCATGTCTCCAAGGGCCCTG
GCTGAAAAGGAGCCGCTCAAGATGCCTGGGGTCTCCTTGGTGGGCCGCGTCAATGCCTGGAGTTGCTGC
CCCTTCCAGTACCATGGACAGCCCATCTATCCGGGCCCCCTGGGGGCACTGCCTCAGAGTCCTGTCCCC
AGCCTGGGCCTTTGGAGGAAGAGCCCAGCCTTTCCCGGGGAGCTGGCGCACCTCTGCAAGGATGTGGAC
GGCCTGGGGCAGAAGGTGTGCAGGCCCGTGGTGCTGAAACCCATCCCCACCAAGCCAGCCGTGCCCCCA
CCCATCTTCAATGTCTTTGGCTACCTCTAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_138344
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138344.4
RefSeq Size 1848 bp
RefSeq ORF 1065 bp
Locus ID 90050
UniProt ID Q8N9Y4
Cytogenetics 14q32.12
MW 38.7 kDa
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_138344" in other vectors (5)
SKU Description Size Price
RC215264 FAM181A (Myc-DDK-tagged)-Human family with sequence similarity 181, member A (FAM181A), transcript variant 1 10 ug
$457.00
RC215264L3 Lenti ORF clone of Human family with sequence similarity 181, member A (FAM181A), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC215264L4 Lenti ORF clone of Human family with sequence similarity 181, member A (FAM181A), transcript variant 1, mGFP tagged 10 ug
$757.00
RG215264 FAM181A (tGFP-tagged) - Human family with sequence similarity 181, member A (FAM181A), transcript variant 1 10 ug
$657.00
SC123130 FAM181A (untagged)-Human family with sequence similarity 181, member A (FAM181A), transcript variant 1 10 ug
$300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products