OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TMEM204 (NM_024600) Human Untagged Clone

Be the first to review this product
SKU
SC317327
TMEM204 (untagged)-Human transmembrane protein 204 (TMEM204)
  $480.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA320015 Rabbit Polyclonal TMEM204 Antibody
100 ug
$640.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TMEM204 or NM_024600"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TMEM204
Synonyms C16orf30; CLP24
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317327 representing NM_024600.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCGTGCAGAGACTCGTGGCCGCGGCCGTGCTGGTGGCCCTGGTCTCACTCATCCTCAACAACGTG
GCGGCCTTCACCTCCAACTGGGTGTGCCAGACGCTGGAGGATGGGCGCAGGCGCAGCGTGGGGCTGTGG
AGGTCCTGCTGGCTGGTGGACAGGACCCGGGGAGGGCCGAGCCCTGGGGCCAGAGCCGGCCAGGTGGAC
GCACATGACTGTGAGGCGCTGGGCTGGGGCTCCGAGGCAGCCGGCTTCCAGGAGTCCCGAGGCACCGTC
AAACTGCAGTTCGACATGATGCGCGCCTGCAACCTGGTGGCCACGGCCGCGCTCACCGCAGGCCAGCTC
ACCTTCCTCCTGGGGCTGGTGGGCCTGCCCCTGCTGTCACCCGACGCCCCGTGCTGGGAGGAGGCCATG
GCCGCTGCATTCCAACTGGCGAGTTTTGTCCTGGTCATCGGGCTCGTGACTTTCTACAGAATTGGCCCA
TACACCAACCTGTCCTGGTCCTGCTACCTGAACATTGGCGCCTGCCTTCTGGCCACGCTGGCGGCAGCC
ATGCTCATCTGGAACATTCTCCACAAGAGGGAGGACTGCATGGCCCCCCGGGTGATTGTCATCAGCCGC
TCCCTGACAGCGCGCTTTCGCCGTGGGCTGGACAATGACTACGTGGAGTCACCATGCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_024600
Insert Size 681 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024600.5
RefSeq Size 1868 bp
RefSeq ORF 681 bp
Locus ID 79652
UniProt ID Q9BSN7
Cytogenetics 16p13.3
Protein Families Transmembrane
MW 24.5 kDa
Summary C16ORF30 plays a role in cell adhesion and cellular permeability at adherens junctions (Kearsey et al., 2004 PubMed 15206924).supplied by OMIM, Mar 2008
Transcript Variant: This variant (1) represents the longer transcript. Both variants encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_024600" in other vectors (7)
SKU Description Size Price
RC202534 TMEM204 (Myc-DDK-tagged)-Human transmembrane protein 204 (TMEM204) 10 ug
$450.00
RC202534L1 Lenti ORF clone of Human transmembrane protein 204 (TMEM204), Myc-DDK-tagged 10 ug
$750.00
RC202534L2 Lenti ORF clone of Human transmembrane protein 204 (TMEM204), mGFP tagged 10 ug
$750.00
RC202534L3 Lenti ORF clone of Human transmembrane protein 204 (TMEM204), Myc-DDK-tagged 10 ug
$750.00
RC202534L4 Lenti ORF clone of Human transmembrane protein 204 (TMEM204), mGFP tagged 10 ug
$750.00
RG202534 TMEM204 (tGFP-tagged) - Human transmembrane protein 204 (TMEM204) 10 ug
$650.00
SC319106 TMEM204 (untagged)-Human transmembrane protein 204 (TMEM204) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products