CENPM (NM_001110215) Human Untagged Clone

SKU SC317005

CENPM (untagged)-Human centromere protein M (CENPM), transcript variant 3

Product Data

• Type: Human Untagged Clone
• Target Symbol: CENPM
• Synonyms: C22orf18; CENP-M; PANE1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC317005 representing NM_001110215.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGGGCCGAGTGTGGGACTTGCCTGGTGTGCTCAAGGTGGAAGGCTTTAGGGCCACCATGGCGCAGCGC; CTGGTGCGCGTGCTGCAGATCTGTGCTGGCCACGTGCCCGGTGTCTCAGCTCTGAACCTGCTGTCCCTG; CTGAGAAGCTCTGAGGGCCCCTCCCTGGAGGACCTGTGA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001110215
• Insert Size: 177 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001110215.2
• RefSeq Size: 557 bp
• RefSeq ORF: 177 bp
• Locus ID: 79019
• UniProt ID: Q9NSP4
• Cytogenetics: 22q13.2
• Protein Families: Druggable Genome
• MW: 6.3 kDa
• Summary: The protein encoded by this gene is an inner protein of the kinetochore, the multi-protein complex that binds spindle microtubules to regulate chromosome segregation during cell division. It belongs to the constitutive centromere-associated network protein group, whose members interact with outer kinetochore proteins and help to maintain centromere identity at each cell division cycle. The protein is structurally related to GTPases but cannot bind guanosine triphosphate. A point mutation that affects interaction with another constitutive centromere-associated network protein, CENP-I, impairs kinetochore assembly and chromosome alignment, suggesting that it is required for kinetochore formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]; Transcript Variant: This variant (3) has a distinct 5' UTR and lacks a portion of the 5' coding region compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (c) with a shorter N-terminus compared to isoform a.