OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CACNB1 (NM_199248) Human Untagged Clone

Be the first to review this product
SKU
SC315571
CACNB1 (untagged)-Human calcium channel, voltage-dependent, beta 1 subunit (CACNB1), transcript variant 3
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA809369 CACNB1 mouse monoclonal antibody,clone OTI3H6 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CACNB1 or NM_199248"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CACNB1
Synonyms CAB1; CACNLB1; CCHLB1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315571 representing NM_199248.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTCCAGAAGACCAGCATGTCCCGGGGCCCTTACCCACCCTCCCAGGAGATCCCCATGGAGGTCTTC
GACCCCAGCCCGCAGGGCAAATACAGCAAGAGGAAAGGGCGATTCAAACGGTCAGATGGGAGCACGTCC
TCGGATACCACATCCAACAGCTTTGTCCGCCAGGGCTCAGCGGAGTCCTACACCAGCCGTCCATCAGAC
TCTGATGTATCTCTGGAGGAGGACCGGGAAGCCTTAAGGAAGGAAGCAGAGCGCCAGGCATTAGCGCAG
CTCGAGAAGGCCAAGACCAAGCCAGTGGCATTTGCTGTGCGGACAAATGTTGGCTACAATCCGTCTCCA
GGGGATGAGGTGCCTGTGCAGGGAGTGGCCATCACCTTCGAGCCCAAAGACTTCCTGCACATCAAGGAG
AAATACAATAATGACTGGTGGATCGGGCGGCTGGTGAAGGAGGGCTGTGAGGTTGGCTTCATTCCCAGC
CCCGTCAAACTGGACAGCCTTCGCCTGCTGCAGGAACAGAAGCTGCGCCAGAACCGCCTCGGCTCCAGC
AAATCAGGCGATAACTCCAGTTCCAGTCTGGGAGATGTGGTGACTGGCACCCGCCGCCCCACACCCCCT
GCCAGTGCCAAACAGAAGCAGAAGTCGACAGAGCATGTGCCCCCCTATGACGTGGTGCCTTCCATGAGG
CCCATCATCCTGGTGGGACCGTCGCTCAAGGGCTACGAGGTTACAGACATGATGCAGAAAGCTTTATTT
GACTTCTTGAAGCATCGGTTTGATGGCAGGATCTCCATCACTCGTGTGACGGCAGATATTTCCCTGGCT
AAGCGCTCAGTTCTCAACAACCCCAGCAAACACATCATCATTGAGCGCTCCAACACACGCTCCAGCCTG
GCTGAGGTGCAGAGTGAAATCGAGCGAATCTTCGAGCTGGCCCGGACCCTTCAGTTGGTCGCTCTGGAT
GCTGACACCATCAATCACCCAGCCCAGCTGTCCAAGACCTCGCTGGCCCCCATCATTGTTTACATCAAG
ATCACCTCTCCCAAGGTACTTCAAAGGCTCATCAAGTCCCGAGGAAAGTCTCAGTCCAAACACCTCAAT
GTCCAAATAGCGGCCTCGGAAAAGCTGGCACAGTGCCCCCCTGAAATGTTTGACATCATCCTGGATGAG
AACCAATTGGAGGATGCCTGCGAGCATCTGGCGGAGTACTTGGAAGCCTATTGGAAGGCCACACACCCG
CCCAGCAGCACGCCACCCAATCCGCTGCTGAACCGCACCATGGCTACCGCAGCCCTGGCTGCCAGCCCT
GCCCCTGTCTCCAACCTCCAGGTACAGGTGCTCACCTCGCTCAGGAGAAACCTCGGCTTCTGGGGCGGG
CTGGAGTCCTCACAGCGGGGCAGTGTGGTGCCCCAGGAGCAGGAACATGCCATGTAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_199248
Insert Size 1437 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199248.2
RefSeq Size 1770 bp
RefSeq ORF 1437 bp
Locus ID 782
UniProt ID Q02641
Cytogenetics 17q12
Protein Families Druggable Genome, Ion Channels: Other
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
MW 53 kDa
Summary The protein encoded by this gene belongs to the calcium channel beta subunit family. It plays an important role in the calcium channel by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. provided by RefSeq, Jul 2008
Transcript Variant: This variant (3), also known as beta-1b1, betaB, and beta-1c, differs in the 3' UTR and 3' coding region, compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_199248" in other vectors (4)
SKU Description Size Price
RC220047 CACNB1 (Myc-DDK-tagged)-Human calcium channel, voltage-dependent, beta 1 subunit (CACNB1), transcript variant 3 10 ug
$457.00
RC220047L3 Lenti ORF clone of Human calcium channel, voltage-dependent, beta 1 subunit (CACNB1), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC220047L4 Lenti ORF clone of Human calcium channel, voltage-dependent, beta 1 subunit (CACNB1), transcript variant 3, mGFP tagged 10 ug
$757.00
RG220047 CACNB1 (tGFP-tagged) - Human calcium channel, voltage-dependent, beta 1 subunit (CACNB1), transcript variant 3 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products