OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MCL1 (NM_021960) Human Untagged Clone

Be the first to review this product
SKU
SC315538
MCL1 (untagged)-Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1
  $686.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA501036 Anti-MCL1 mouse monoclonal antibody, clone OTI10F6 (formerly 10F6) 100 ul
$447.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MCL1 or NM_021960"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MCL1
Synonyms bcl2-L-3; BCL2L3; EAT; Mcl-1; MCL1-ES; mcl1/EAT; MCL1L; MCL1S; TM
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_021960 edited
ATGTTTGGCCTCAAAAGAAACGCGGTAATCGGACTCAACCTCTACTGTGGGGGGGCCGGC
TTGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACTTTTGGCTACGGAGAAG
GAGGCCTCGGCCCGGCGAGAGATAGGGGGAGGGGAGGCCGGCGCGGTGATTGGCGGAAGC
GCCGGCGCAAGCCCCCCGTCCACCCTCACGCCAGACTCCCGGAGGGTCGCGCGGCCGCCG
CCCATTGGCGCCGAGGTCCCCGACGTCACCGCGACCCCCGCGAGGCTGCTTTTCTTCGCG
CCCACCCGCCGCGCGGCGCCGCTTGAGGAGATGGAAGCCCCGGCCGCTGACGCCATCATG
TCGCCCGAAGAGGAGCTGGACGGGTACGAGCCGGAGCCTCTCGGGAAGCGGCCGGCTGTC
CTGCCGCTGCTGGAGTTGGTCGGGGAATCTGGTAATAACACCAGTACGGACGGGTCACTA
CCCTCGACGCCGCCGCCAGCAGAGGAGGAGGAGGACGAGTTGTACCGGCAGTCGCTGGAG
ATTATCTCTCGGTACCTTCGGGAGCAGGCCACCGGCGCCAAGGACACAAAGCCAATGGGC
AGGTCTGGGGCCACCAGCAGGAAGGCGCTGGAGACCTTACGACGGGTTGGGGATGGCGTG
CAGCGCAACCACGAGACGGCCTTCCAAGGCATGCTTCGGAAACTGGACATCAAAAACGAA
GACGATGTGAAATCGTTGTCTCGAGTGATGATCCATGTTTTCAGCGACGGCGTAACAAAC
TGGGGCAGGATTGTGACTCTCATTTCTTTTGGTGCCTTTGTGGCTAAACACTTGAAGACC
ATAAACCAAGAAAGCTGCATCGAACCATTAGCAGAAAGTATCACAGACGTTCTCGTAAGG
ACAAAACGGGACTGGCTAGTTAAACAAAGAGGCTGGGATGGGTTTGTGGAGTTCTTCCAT
GTAGAGGACCTAGAAGGTGGCATCAGGAATGTGCTGCTGGCTTTTGCAGGTGTTGCTGGA
GTAGGAGCTGGTTTGGCATATCTAATAAGATAG
Restriction Sites NotI-NotI |
ACCN NM_021960
Insert Size 2400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021960.3.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_021960.3, NP_068779.1
RefSeq Size 4020 bp
RefSeq ORF 1053 bp
Locus ID 4170
UniProt ID Q07820
Cytogenetics 1q21.2
Domains Bcl-2
Protein Families Druggable Genome, Transmembrane
Summary This gene encodes an anti-apoptotic protein, which is a member of the Bcl-2 family. Alternative splicing results in multiple transcript variants. The longest gene product (isoform 1) enhances cell survival by inhibiting apoptosis while the alternatively spliced shorter gene products (isoform 2 and isoform 3) promote apoptosis and are death-inducing. provided by RefSeq, Oct 2010
Transcript Variant: This variant (1), also known as MCL-1L (long), represents the longest transcript and encodes the longest isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_021960" in other vectors (6)
SKU Description Size Price
RC200521 MCL1 (Myc-DDK-tagged)-Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$686.00
RC200521L1 Lenti ORF clone of Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC200521L2 Lenti ORF clone of Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$986.00
RC200521L3 Lenti ORF clone of Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC200521L4 Lenti ORF clone of Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$986.00
RG200521 MCL1 (tGFP-tagged) - Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$886.00

file-alt Citations

Sensitizing non-small cell lung cancer to BCL-xL-targeted apoptosis
Shen, Li, Mai et al
Cell Death Dis (2018) 9 (10), 986 DOI: 10.1038/s41419-018-1040-9
AI Summary: OriGene’s MCL-1 overexpression plasmid (#SC315538) was used to increase MCL-1 levels in NSCLC cell lines, enabling the study of how MCL-1 expression affects sensitivity to BCL-xL-targeted apoptosis therapies.
Snippet: analysis. MCL-1 overexpression in H727 or A549 cells. H727 or A549 cells were transfected with a MCL-1 overexpression plasmid (#SC315538, Origene, Rockville, MD, USA) using lipofectamine 3000 as the transfection reagent
Proteasome inhibition enhances the efficacy of volasertib-induced mitotic arrest in AML in vitro and prolongs survival in vivo
Schnerch, Schüler, Follo et al
Oncotarget (2017) 8 (13), 21153-21166 DOI: 10.18632/oncotarget.15503
Snippet: For inducible overexpression of Mcl-1 the coding sequence was PCR-amplified from Origene cDNA clone SC315538 (NM_021960) using AAAAAAGGATCCATG TTTGGCCTCAAAAGAAACG as a sense primer and AAAAAAACGCGTCTATCTTATTAGATATGCCAAAC as a reverse primer
FigureFigureFigure
FBXW7 Mediates Chemotherapeutic Sensitivity and Prognosis in NSCLC
Yokobori, Yokoyama, Mogi et al
Mol. Cancer Res. (2013)
AI Summary: OriGene’s MCL1 antibody was used for Western blot analysis to detect MCL1 protein expression in lung cancer cell lines, contributing to the study’s investigation of FBXW7-mediated regulation in NSCLC.
Snippet: respectively. Protein extraction and Western blot analysis Western blot analysis was used to confirm the expression of FBXW7 (Abnova, Taipei City, Taiwan), TOP2A (Abcam, Cambridge, UK), MCL1 (Origene, Rockville, MD, USA), and β-actin in the lung cancer cell lines
Targeting acute myeloid leukemia by dual inhibition of PI3K signaling and Cdk9-mediated Mcl-1 transcription
Thomas, Powell, Vergez et al
Blood (2013) 122 (5), 738-48 DOI: 10.1182/blood-2012-08-447441
Cited by 65
AI Summary: OriGene’s Mcl-1 expression plasmid was used to overexpress Mcl-1 in MV4;11 cells, enabling the authors to study the functional impact of Mcl-1 modulation on apoptosis in acute myeloid leukemia.
Snippet: MV4;11 cells were electroporated (250mV, 1000mF) with 10μg of an Mcl-1 expression plasmid (Origene) or a plasmid expressing myr-Akt. MV4;11 cells ... Mcl-1 is known to have a short half-life owing to its ubiquitination and targeting for degradation via the proteasome.
Overexpression of Mcl-1 confers multidrug resistance, whereas topoisomerase IIβ downregulation introduces mitoxantrone-specific drug resistance in acute myeloid leukemia
Hermanson, Das, Li et al
Mol. Pharmacol. (2013) 84 (2), 236-43 DOI: 10.1124/mol.113.086140
Cited by 42
AI Summary: In this study, the Mcl-1 overexpression plasmid (SC315538) from OriGene was used to investigate how increased Mcl-1 levels contribute to multidrug resistance in acute myeloid leukemia cells.
Snippet: Cells were either transfected with 12.5 nM siRNA (based on 2.5 mL re- suspension volume) from Life Technologies or 5 µg of plasmid containing the Mcl-1 open reading frame (SC315538) from OriGene (Rockville, MD). Down-regulation was assessed after
N-α-acetyltransferase 10 protein inhibits apoptosis through RelA/p65-regulated MCL1 expression
Xu, Jiang, Meng et al
Carcinogenesis (2012) 33 (6), 1193-202 DOI: 10.1093/carcin/bgs144
Cited by 48
AI Summary: OriGene products contributed to this study by providing the XL4-MCL1 plasmid (sc315538) and the pCMV6-A-Puro vector (PS100025), which were used for manipulating MCL1 expression to investigate the regulatory role of Naa10p in apoptosis.
Snippet: XL4-MCL1 plasmid (sc315538) from Origene (Rockville, MD) and then cloned into pCMV6-A-Puro vector (PS100025) (Origene). ... Targeted sequence for short hairpin RNA (shRNA)-induced silencing of Naa10p was 5′-CCCUGCACCUCUAUUCCAA-3′, using
Showing 1-6 of 10 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products