OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SF2 (SRSF1) (NM_001078166) Human Untagged Clone

Be the first to review this product
SKU
SC315487
SRSF1 (untagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA385321 SF2 Rabbit monoclonal Antibody
100 ul
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SF2 or NM_001078166"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SF2
Synonyms ASF; SF2; SF2p33; SFRS1; SRp30a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315487 representing NM_001078166.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGGGAGGTGGTGTGATTCGTGGCCCCGCAGGGAACAACGATTGCCGCATCTACGTGGGTAACTTA
CCTCCAGACATCCGAACCAAGGACATTGAGGACGTGTTCTACAAATACGGCGCTATCCGCGACATCGAC
CTCAAGAATCGCCGCGGGGGACCGCCCTTCGCCTTCGTTGAGTTCGAGGACCCGCGAGACGCGGAAGAC
GCGGTGTATGGTCGCGACGGCTATGATTACGATGGGTACCGTCTGCGGGTGGAGTTTCCTCGAAGCGGC
CGTGGAACAGGCCGAGGCGGCGGCGGGGGTGGAGGTGGCGGAGCTCCCCGAGGTCGCTATGGCCCCCCA
TCCAGGCGGTCTGAAAACAGAGTGGTTGTCTCTGGACTGCCTCCAAGTGGAAGTTGGCAGGATTTAAAG
GATCACATGCGTGAAGCAGGTGATGTATGTTATGCTGATGTTTACCGAGATGGCACTGGTGTCGTGGAG
TTTGTACGGAAAGAAGATATGACCTATGCAGTTCGAAAACTGGATAACACTAAGTTTAGATCTCATGAG
GTAGGTTATACACGTATTCTTTTCTTTGACCAGAATTGGATACAGTGGTCTTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001078166
Insert Size 606 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001078166.1
RefSeq Size 5668 bp
RefSeq ORF 606 bp
Locus ID 6426
UniProt ID Q07955
Cytogenetics 17q22
Protein Families Stem cell - Pluripotency
Protein Pathways Spliceosome
MW 22.5 kDa
Summary This gene encodes a member of the arginine/serine-rich splicing factor protein family. The encoded protein can either activate or repress splicing, depending on its phosphorylation state and its interaction partners. Multiple transcript variants have been found for this gene. There is a pseudogene of this gene on chromosome 13. provided by RefSeq, Jun 2014
Transcript Variant: This variant (2) includes an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2, also known as ASF-3) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001078166" in other vectors (6)
SKU Description Size Price
RC213304 SRSF1 (Myc-DDK-tagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2 10 ug
$300.00
RC213304L1 Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC213304L2 Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2, mGFP tagged 10 ug
$600.00
RC213304L3 Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC213304L4 Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG213304 SRSF1 (tGFP-tagged) - Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2 10 ug
$500.00

file-alt Citations

Vitamin A metabolite, all-trans-retinoic acid, mediates alternative splicing of protein kinase C deltaVIII (PKCdeltaVIII) isoform via splicing factor SC35
Apostolatos, Apostolatos, Vickers et al
J Biol Chem (2010) 285 (34), 25987-95 DOI: 10.1074/jbc.M110.100735
AI Summary: OriGene’s pSPL3 splicing vector was used to construct a PKCdelta minigene, enabling the authors to investigate how all-trans-retinoic acid and the splicing factor SC35 regulate alternative splicing of the PKCdeltaVIII isoform.
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products