SEMA6D (NM_024966) Human Untagged Clone

SKU
SC313647
SEMA6D (untagged)-Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6
$732.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SEMA6D
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313647 representing NM_024966.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGGTCTTCCTGCTTTGTGCCTACATACTGCTGCTGATGGTTTCCCAGTTGAGGGCAGTCAGCTTT
CCTGAAGATGATGAACCCCTTAATACTGTCGACTATCACTATTCAAGGCAATATCCGGTTTTTAGAGGA
CGCCCTTCAGGCAATGAATCGCAGCACAGGCTGGACTTTCAGCTGATGTTGAAAATTCGAGACACACTT
TATATTGCTGGCAGGGATCAAGTTTATACAGTAAACTTAAATGAAATGCCCAAAACAGAAGTAATACCC
AACAAGAAACTGACATGGCGATCAAGACAACAGGATCGAGAAAACTGTGCTATGAAAGGCAAGCATAAA
GATGAATGCCACAACTTTATCAAAGTATTTGTTCCAAGAAACGATGAGATGGTTTTTGTTTGTGGTACC
AATGCATTCAATCCCATGTGTAGATACTACAGGTTGAGTACCTTAGAATATGATGGGGAAGAAATTAGT
GGCCTGGCAAGATGCCCATTTGATGCCAGACAAACCAATGTTGCCCTCTTTGCTGATGGGAAGCTGTAT
TCTGCCACAGTGGCTGACTTCTTGGCCAGCGATGCCGTTATTTATCGAAGCATGGGTGATGGATCTGCC
CTTCGCACAATAAAATATGATTCCAAATGGATAAAAGAGCCACACTTTCTTCATGCCATAGAATATGGA
AACTATGTCTATTTCTTCTTTCGAGAAATCGCTGTCGAACATAATAATTTAGGCAAGGCTGTGTATTCC
CGCGTGGCCCGCATATGTAAAAACGACATGGGTGGTTCCCAGCGGGTCCTGGAGAAACACTGGACTTCA
TTTCTAAAGGCTCGGCTGAACTGTTCTGTCCCTGGAGATTCGTTTTTCTACTTTGATGTTCTGCAGTCT
ATTACAGACATAATACAAATCAATGGCATCCCCACTGTGGTCGGGGTGTTTACCACGCAGCTCAATAGC
ATCCCTGGTTCTGCTGTCTGTGCATTTAGCATGGATGACATTGAAAAAGTATTCAAAGGACGGTTTAAG
GAACAGAAAACTCCAGATTCTGTTTGGACAGCAGTTCCCGAAGACAAAGTGCCAAAGCCAAGGCCTGGC
TGTTGTGCAAAACACGGCCTTGCCGAAGCTTATAAAACCTCCATCGATTTCCCGGATGAAACTCTGTCA
TTCATCAAATCTCATCCCCTGATGGACTCTGCCGTTCCACCCATTGCCGATGAGCCCTGGTTCACAAAG
ACTCGGGTCAGGTACAGACTGACGGCCATCTCAGTGGACCATTCAGCCGGACCCTACCAGAACTACACA
GTCATCTTTGTTGGCTCTGAAGCTGGCATGGTACTTAAAGTTCTGGCAAAGACCAGTCCTTTCTCTTTG
AACGACAGCGTATTACTGGAAGAGATTGAAGCCTACAACCATGCAAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_024966
Insert Size 1431 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024966.2
RefSeq Size 2290 bp
RefSeq ORF 1431 bp
Locus ID 80031
UniProt ID Q8NFY4
Cytogenetics 15q21.1
Domains Sema
Protein Families Druggable Genome, Transmembrane
Protein Pathways Axon guidance
MW 54.2 kDa
Summary Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (6) represents the shortest transcript and encodes the shortest isoform (6). Lacking a PSI domain and a predicted transmembrane domain, isoform 6 is considered a putative secreted protein.
Write Your Own Review
You're reviewing:SEMA6D (NM_024966) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214172 SEMA6D (Myc-DDK-tagged)-Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6 10 ug
$686.00
RC214172L1 Lenti ORF clone of Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6, Myc-DDK-tagged 10 ug
$986.00
RC214172L2 Lenti ORF clone of Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6, mGFP tagged 10 ug
$986.00
RC214172L3 Lenti ORF clone of Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6, Myc-DDK-tagged 10 ug
$986.00
RC214172L4 Lenti ORF clone of Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6, mGFP tagged 10 ug
$986.00
RG214172 SEMA6D (tGFP-tagged) - Human sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D), transcript variant 6 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.