OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cell adhesion molecule 2 (CADM2) (NM_153184) Human Untagged Clone

Be the first to review this product
SKU
SC313469
CADM2 (untagged)-Human cell adhesion molecule 2 (CADM2), transcript variant 3
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Cell adhesion molecule 2 or NM_153184"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Cell adhesion molecule 2
Synonyms IGSF4D; Necl-3; NECL3; SynCAM 2; synCAM2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313469 representing NM_153184.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTTGTTCTCTTCTTGTGCAACCTTTCCTTGGTACCAGCGGCTGCTTCAAAGAATAAAGTTAAAGGC
AGCCAAGGGCAGTTTCCACTAACACAGAATGTAACCGTTGTTGAAGGTGGAACTGCAATTTTGACCTGC
AGGGTTGATCAAAATGATAACACCTCCCTCCAGTGGTCAAATCCAGCTCAACAGACTCTGTACTTTGAC
GACAAGAAAGCTTTAAGGGACAATAGGATCGAGCTGGTTCGCGCTTCCTGGCATGAATTGAGTATTAGT
GTCAGTGATGTGTCTCTCTCTGATGAAGGACAGTACACCTGTTCTTTATTTACAATGCCTGTCAAAACT
TCCAAGGCATATCTCACCGTTCTGGGTGTTCCTGAAAAGCCTCAGATTAGTGGATTCTCATCACCAGTT
ATGGAGGGTGACTTGATGCAGCTGACTTGCAAAACATCTGGTAGTAAACCTGCAGCTGATATAAGATGG
TTCAAAAATGACAAAGAGATTAAAGATGTAAAATATTTAAAAGAAGAGGATGCAAATCGCAAGACATTC
ACTGTCAGCAGCACACTGGACTTCCGAGTGGACCGGAGTGATGATGGAGTGGCGGTCATCTGCAGAGTA
GATCACGAATCCCTCAATGCCACCCCTCAGGTAGCCATGCAGGTGCTAGAAATACACTATACACCATCA
GTTAAGATTATACCATCGACTCCTTTTCCACAAGAAGGACAGCCTTTAATTTTGACTTGTGAATCCAAA
GGAAAACCACTGCCAGAACCTGTTTTGTGGACAAAGGATGGCGGAGAATTACCAGATCCTGACCGAATG
GTTGTGAGTGGTAGGGAGCTAAACATTCTTTTCCTGAACAAAACGGATAATGGTACATATCGATGTGAA
GCCACAAACACCATTGGCCAAAGCAGTGCGGAATATGTTCTCATTGTGCATGATGTTCCCAACACTTTG
CTTCCCACTACTATCATCCCCTCCCTTACCACTGCAACAGTCACAACCACTGTAGCCATAACAACCAGC
CCAACCACATCTGCAACAACCAGCAGCATCAGAGATCCTAATGCTTTGGCTGGCCAGAATGGCCCTGAC
CATGCTCTCATAGGAGGAATAGTGGCTGTAGTTGTATTTGTCACGCTGTGTTCTATCTTTCTGCTTGGT
CGATATCTGGCAAGGCATAAAGGAACGTATTTAACAAATGAAGCTAAAGGAGCTGAAGATGCACCAGAT
GCTGATACAGCCATTATCAATGCTGAAGGCAGCCAAGTCAATGCTGAAGAGAAAAAAGAGTATTTCATT
TAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_153184
Insert Size 1314 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_153184.3
RefSeq Size 8960 bp
RefSeq ORF 1314 bp
Locus ID 253559
UniProt ID Q8N3J6
Cytogenetics 3p12.1
Domains ig, IG, IGc2
Protein Families Druggable Genome, Transmembrane
MW 47.6 kDa
Summary This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Feb 2012
Transcript Variant: This variant (3) represents a distinct 5' coding region, compared to variant 1. The resulting isoform (3) has a longer and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_153184" in other vectors (6)
SKU Description Size Price
RC218787 CADM2 (Myc-DDK-tagged)-Human cell adhesion molecule 2 (CADM2), transcript variant 3 10 ug
$289.00 $457.00
RC218787L1 Lenti ORF clone of Human cell adhesion molecule 2 (CADM2), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC218787L2 Lenti ORF clone of Human cell adhesion molecule 2 (CADM2), transcript variant 3, mGFP tagged 10 ug
$757.00
RC218787L3 Lenti ORF clone of Human cell adhesion molecule 2 (CADM2), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC218787L4 Lenti ORF clone of Human cell adhesion molecule 2 (CADM2), transcript variant 3, mGFP tagged 10 ug
$757.00
RG218787 CADM2 (tGFP-tagged) - Human cell adhesion molecule 2 (CADM2), transcript variant 3 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products