OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MPPED1 (NM_001044370) Human Untagged Clone

Be the first to review this product
SKU
SC311469
MPPED1 (untagged)-Human metallophosphoesterase domain containing 1 (MPPED1)
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA358228 MPPED1 Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MPPED1 or NM_001044370"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MPPED1
Synonyms 239AB; C22orf1; FAM1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC311469 representing NM_001044370.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGGCGCTCTAGGTGGGATGCCAGCGTCCTGAAGGCGGAGGCCCTGGCCCTCCTCCCCTGCGGCCTG
GGCATGGCATTCTCCCAGTCCCACGTGATGGCCGCTCGGCGGCACCAGCACAGCCGGCTCATCATCGAG
GTGGACGAGTACAGCTCCAACCCCACCCAGGCCTTCACCTTCTACAACATCAACCAGGGCCGCTTCCAG
CCACCGCATGTGCAGATGGTGGACCCGGTGCCTCACGATGCCCCCAAACCTCCAGGCTACACCCGCTTC
GTCTGCGTCTCTGATACCCACTCGAGGACGGACCCCATCCAGATGCCGTACGGCGACGTGCTGATCCAC
GCTGGGGACTTCACTGAGCTGGGGCTCCCGAGCGAGGTGAAGAAGTTCAACGAGTGGCTGGGCAGCCTG
CCCTACGAGTACAAGATCGTGATCGCAGGCAACCACGAGCTGACCTTTGACCAGGAGTTCATGGCCGAC
CTCATCAAGCAGGACTTTTACTACTTCCCATCTGTGTCGAAGCTGAAGCCGGAGAACTATGAGAATGTG
CAGTCGCTGCTGACCAACTGCATCTACCTTCAGGACTCGGAGGTCACCGTGCGGGGCTTCCGGATCTAT
GGCTCCCCATGGCAGCCCTGGTTCTACGGCTGGGGCTTCAACCTCCCGCGAGGCCAAGCCCTGCTGGAG
AAATGGAACCTCATTCCCGAAGGCGTAGACATCCTGATAACCCATGGACCACCACTGGGCTTCCTGGAC
TGGGTCCCCAAGAAGATGCAGCGGGTGGGCTGTGTGGAGCTGCTCAACACGGTGCAGAGGCGCGTCCAG
CCGCGGTTACATGTCTTTGGCCACATCCACGAAGGGTATGGTGTCATGGCAGATGGGACGACCACCTAT
GTGAATGCGTCCGTATGCACTGTGAACTACCAGCCCGTGAACCCGCCCATAGTCATCGACCTCCCCACA
CCCCGGAACTCCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001044370
Insert Size 981 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001044370.1
RefSeq Size 2531 bp
RefSeq ORF 981 bp
Locus ID 758
UniProt ID O15442
Cytogenetics 22q13.2
Protein Families Transcription Factors
MW 37.2 kDa
Summary May have metallophosphoesterase activity (in vitro).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001044370" in other vectors (4)
SKU Description Size Price
RC207024 MPPED1 (Myc-DDK-tagged)-Human metallophosphoesterase domain containing 1 (MPPED1) 10 ug
$300.00
RC207024L3 Lenti ORF clone of Human metallophosphoesterase domain containing 1 (MPPED1), Myc-DDK-tagged 10 ug
$600.00
RC207024L4 Lenti ORF clone of Human metallophosphoesterase domain containing 1 (MPPED1), mGFP tagged 10 ug
$600.00
RG207024 MPPED1 (tGFP-tagged) - Human metallophosphoesterase domain containing 1 (MPPED1) 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products