OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

NAT8B (NM_016347) Human Untagged Clone

Be the first to review this product
SKU
SC311351
NAT8B (untagged)-Human N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) (NAT8B)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "NAT8B or NM_016347"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NAT8B
Synonyms CML2; Hcml2; NAT8BP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_016347 edited
TCTAGCCCCTGGACTCAGTGACTTCAGACACAGAAGTCTGTCCATGGCTCCTTATCACAT
CCGCAAATACCAGGAGAGCGACCGCAAGTCGGTCGTGGGCTTGCTCTCCGGGGGGATGGC
CGAACACGCCCCAGCCACCTTCCGGCGATTACTGAAGCTGCCTCGAACCCTCATACTCTT
ACTTGGGGGGGCCCTTGCCCTACTCCTGGTCTCTGGCTCCTGGATTCTGGCCCTCGTGTT
CAGCCTCAGCCTCCTTCCTGCCCTGTGGTTCCTTGCCAAAAAACCCTGGACGCGGTATGT
AGACATAGCATTGCGCACAGACATGTCTGACATCACCAAATCCTACCTGAGTGAKKGTGG
CTCCTGCTTCTGGGTGGCTGAATCTGAAGAGAAGGTGGTGGGCACAGTAGGAGCTCTGCC
CGTTGATGATCCCACCTTGAGGGAGAAGCGGTTGCAGCTGTTTCATCTCTCTGTGGACAA
TGAGCACCGTGGTCAGGGGATAGCAAAAGCCCTGGTCAGGACTGTCCTCCAGTTTGCCCG
GGACCAGGGCTACAGTGAAGTTGTCCTGGACACCAGCAACATCCAGCTCTCTGCCATGGG
CCTCTACCAGAGCTTGGGCTTCAAGAAGACGGGCCAGTCCTTCTTCCACGTGTGGGCCAG
GCTGGTGGATCTTCATACAGTTCATTTCATCTATCACCTCCCTTCTGCTCAGGCAGGGCG
TCTATGATTTCTTTCCTTCTGTATTGGTCAGAATAGAATCCATTCGGCTGTAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_016347 unedited
NAGGTTAGATTTGTATACGACTCATATAGGCGGCCGCTCTAGCCCCTGGNCTCAGTGACT
TCANACACAGAAGTCTGTCCATGGCTCCTTATCACATCCGCAAAACCAGGAGAGCGACCG
CAAGTCGGTCGTGGGCTTGCTCTCCGGGGGGATGGCCGAACACGCCCCAGCCACCTTCCG
GCGATTACTGAAGCTGCCTCGAACCCTCATACTCTTACTTGGGGGGGCCCTTGCCCTACT
CCTGGTCTCTGGCTCCTGGATTCTGGCCCTCGTGTTCAGCCTCAGCCTCCTTCCTGCCCT
GTGGTTCCTTGCCAAAAAACCCTGGACGCGGTATGTAGACATAGCATTGCGCACAGACAT
GTCTGACATCACCAAATCCTACCTGAGTGAGTGTGGCTCCTGCTTCTGGGTGGCTGAATC
TGAAGAGAAGGTGGTGGGCACAGTAGGAGCTCTGCCCGTTGATGATCCCACCTTGAGGGA
GAAGCGGTTGCAGCTGTTTCATCTCTCTGTGGACAATGAGCACCGTGGTCAGGGGATAGC
AAAAGCCCTGGTCAGGACTGTCCTCCAGTTTGCCCGGGACCAGGGCTACAGTGAAGTTGT
CCTGGACACCAGCAACATCCAGCTCTCTGCCATGGGCCTCTACCAGAGCTTGGGCTTCAA
GAAGACGGGCCAGTCCTTCTTCCACGTGTGGGCCAGGCTGGTGGATCTTCATACAGTTCA
TTTCATCTATCACCTCCCTTCTGCTCAGGCAGGGCGTCTATGATTTCTTTCCTTCTGTAT
TGGTCAGAATAGAATCCATTCGGCTGTNAGGCGGATCCCCCCGGCTGCNAGAATTCGATA
TCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCGANTT
Restriction Sites Please inquire |
ACCN NM_016347
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016347.1, NP_057431.1
RefSeq Size 830 bp
RefSeq ORF 684 bp
Locus ID 51471
UniProt ID Q9UHF3
Cytogenetics 2p13.1
Summary The protein encoded by this gene is highly similar to the N-acetyltransferase 8 (NAT8) gene product, which is a kidney and liver protein with homology to bacterial acetyltransferases involved in drug resistance. This gene is localized on chromosome 2 in the vicinity of the NAT8 gene and may represent a pseudogene of NAT8. This gene contains two polymorphic nonsense mutations that disrupt the active site of the protein. The full-length product of this gene contains a complete acetyltransferase domain and is identical in length to NAT8. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) represents the protein coding allele. ##RefSeq-Attributes-START## polymorphic pseudogene :: PMID: 16395595 RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_016347" in other vectors (6)
SKU Description Size Price
RC215647 NAT8B (Myc-DDK-tagged)-Human N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) (NAT8B) 10 ug
$300.00
RC215647L1 Lenti ORF clone of Human N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) (NAT8B), Myc-DDK-tagged 10 ug
$600.00
RC215647L2 Lenti ORF clone of Human N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) (NAT8B), mGFP tagged 10 ug
$600.00
RC215647L3 Lenti ORF clone of Human N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) (NAT8B), Myc-DDK-tagged 10 ug
$600.00
RC215647L4 Lenti ORF clone of Human N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) (NAT8B), mGFP tagged 10 ug
$600.00
RG215647 NAT8B (tGFP-tagged) - Human N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) (NAT8B) 10 ug
$489.00 $500.00

file-alt Citations

Two endoplasmic reticulum (ER)/ER Golgi intermediate compartment-based lysine acetyltransferases post-translationally regulate BACE1 levels
Ko, Puglielli
J Biol Chem (2009) 284 (4), 2482-92 DOI: 10.1074/jbc.M804901200
AI Summary: In this study, OriGene products including ATase1 (OriGene Cat# RC203307) and ATase2 (OriGene Cat# RC209920) expression plasmids were used to investigate the role of these acetyltransferases in the post-translational regulation of BACE1 levels.
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products