OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ATP6V1E1 (NM_001039367) Human Untagged Clone

Be the first to review this product
SKU
SC310913
ATP6V1E1 (untagged)-Human ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 (ATP6V1E1), transcript variant 3
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ATP6V1E1 or NM_001039367"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ATP6V1E1
Synonyms ARCL2C; ATP6E; ATP6E2; ATP6V1E; P31; Vma4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310913 representing NM_001039367.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTCTCAGCGATGCTGACGTGCAAAAGCAGATAAAGCATATGATGGCTTTCATTGAACAAGAAGCC
AATGAGAAAGCAGAAGAAATAGATGCAAAGGCAGAAGAAGAGTTCAACATAGAGAAAGGTCGGCTTGTG
CAAACCCAAAGACTAAAGATTATGGAATATTATGAGAAGAAAGAGAAACAGATTGAGCAGCAGAAGAAA
ATTCAGATGTCCAATTTGATGAATCAAGCGAGACTCAAAGTCCTCAGAGCAAGAGATGACCTTATCACA
GGTTTGTACCAGTTGCTGGAGCCCCGAATGATTGTTCGTTGCAGGAAACAAGATTTCCCTCTGGTAAAG
GCTGCAGTGCAGAAGGCAATTCCTATGTACAAAATTGCCACCAAAAACGATGTTGATGTCCAAATTGAC
CAGGAGTCCTACCTGCCTGAAGACATAGCTGGTGGAGTTGAGATCTATAATGGAGATCGTAAAATAAAG
GTTTCCAACACCCTGGAAAGCCGGCTGGATCTCATAGCCCAGCAGATGATGCCAGAAGTCCGGGGAGCC
TTGTTTGGTGCAAATGCCAACAGGAAGTTTTTGGACTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001039367
Insert Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001039367.1
RefSeq Size 1316 bp
RefSeq ORF 591 bp
Locus ID 529
UniProt ID P36543
Cytogenetics 22q11.21
Protein Pathways Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
MW 22.7 kDa
Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain E subunit isoforms. Pseudogenes for this gene have been found in the genome. provided by RefSeq, Jul 2008
Transcript Variant: This variant (3) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform c), compared to isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001039367" in other vectors (4)
SKU Description Size Price
RC217709 ATP6V1E1 (Myc-DDK-tagged)-Human ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 (ATP6V1E1), transcript variant 3 10 ug
$300.00
RC217709L3 Lenti ORF clone of Human ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 (ATP6V1E1), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC217709L4 Lenti ORF clone of Human ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 (ATP6V1E1), transcript variant 3, mGFP tagged 10 ug
$600.00
RG217709 ATP6V1E1 (tGFP-tagged) - Human ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 (ATP6V1E1), transcript variant 3 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products