OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PICK1 (NM_001039583) Human Untagged Clone

Be the first to review this product
SKU
SC310783
PICK1 (untagged)-Human protein interacting with PRKCA 1 (PICK1), transcript variant 2
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA350769 Rabbit Polyclonal Anti-PICK1 Antibody
100 ul
$205.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PICK1 or NM_001039583"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PICK1
Synonyms PICK; PRKCABP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310783 representing NM_001039583.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTTGCAGACTTGGATTATGACATCGAAGAGGATAAACTCGGAATCCCGACTGTGCCTGGGAAGGTG
ACCCTGCAGAAGGATGCTCAGAACCTGATCGGGATCAGCATTGGAGGAGGGGCCCAGTACTGTCCCTGC
CTCTATATCGTCCAGGTATTTGACAACACCCCAGCAGCCTTGGACGGCACAGTGGCAGCTGGCGATGAG
ATCACCGGTGTCAATGGCAGGTCAATCAAAGGGAAAACTAAGGTGGAGGTGGCGAAGATGATTCAGGAG
GTGAAGGGGGAGGTGACCATCCACTACAACAAGCTGCAGGCGGACCCCAAGCAGGGCATGTCCCTGGAC
ATTGTGTTGAAGAAAGTCAAGCACCGGCTGGTGGAGAACATGAGTTCAGGGACCGCAGATGCTCTGGGC
CTGAGCCGGGCCATCCTGTGCAATGATGGGCTTGTCAAGAGGCTAGAGGAGCTGGAGCGGACCGCTGAG
CTATACAAAGGGATGACGGAACACACCAAGAACCTCCTACGGGCCTTTTATGAGCTGTCGCAGACTCAC
CGGGCCTTTGGGGACGTGTTCTCCGTGATCGGGGTGCGGGAGCCCCAGCCAGCTGCGAGCGAGGCTTTT
GTGAAGTTCGCCGATGCCCACCGCAGCATCGAGAAGTTCGGCATTCGGCTTCTGAAAACCATCAAGCCG
ATGCTGACGGATCTGAACACGTACCTCAACAAAGCCATCCCGGACACTCGCCTCACCATCAAGAAGTAC
CTGGACGTGAAGTTTGAGTACCTGTCGTACTGCCTGAAGGTGAAGGAGATGGATGACGAGGAATACAGC
TGCATTGCCCTAGGCGAGCCCCTTTACCGGGTGAGCACCGGCAACTATGAGTACCGCCTGATCCTGCGC
TGCCGCCAGGAGGCGCGCGCCCGCTTCTCCCAGATGCGCAAGGATGTGCTGGAGAAGATGGAGCTGCTG
GACCAGAAGCACGTCCAGGACATCGTGTTCCAGCTGCAGCGCCTCGTGTCCACCATGTCCAAGTACTAC
AACGACTGCTACGCAGTGCTGCGGGATGCCGACGTCTTCCCCATCGAGGTAGACCTGGCGCACACCACA
TTGGCCTATGGCCTCAACCAGGAGGAGTTCACAGATGGGGAGGAGGAGGAGGAGGAGGAAGACACGGCA
GCTGGGGAGCCGTCCAGGGATACACGAGGGGCTGCTGGGCCCTTGGACAAGGGTGGAAGCTGGTGTGAC
TCCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001039583
Insert Size 1248 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001039583.1
RefSeq Size 2126 bp
RefSeq ORF 1248 bp
Locus ID 9463
UniProt ID Q9NRD5
Cytogenetics 22q13.1
Protein Families Druggable Genome
MW 46.6 kDa
Summary The protein encoded by this gene contains a PDZ domain, through which it interacts with protein kinase C, alpha (PRKCA). This protein may function as an adaptor that binds to and organizes the subcellular localization of a variety of membrane proteins. It has been shown to interact with multiple glutamate receptor subtypes, monoamine plasma membrane transporters, as well as non-voltage gated sodium channels, and may target PRKCA to these membrane proteins and thus regulate their distribution and function. This protein has also been found to act as an anchoring protein that specifically targets PRKCA to mitochondria in a ligand-specific manner. Three transcript variants encoding the same protein have been found for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All three variants encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001039583" in other vectors (4)
SKU Description Size Price
RC222916 PICK1 (Myc-DDK-tagged)-Human protein interacting with PRKCA 1 (PICK1), transcript variant 2 10 ug
$457.00
RC222916L3 Lenti ORF clone of Human protein interacting with PRKCA 1 (PICK1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC222916L4 Lenti ORF clone of Human protein interacting with PRKCA 1 (PICK1), transcript variant 2, mGFP tagged 10 ug
$757.00
RG222916 PICK1 (tGFP-tagged) - Human protein interacting with PRKCA 1 (PICK1), transcript variant 2 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products