OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CABP (CABP1) (NM_031205) Human Untagged Clone

Be the first to review this product
SKU
SC309599
CABP1 (untagged)-Human calcium binding protein 1 (CABP1), transcript variant 1
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA374182 CABP1 Rabbit polyclonal Antibody
100 ul
$410.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CABP or NM_031205"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CABP
Synonyms CALBRAIN; HCALB_BR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC309599 representing NM_031205.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCAACTGTGTCAAGTATCCACTGAGAAATCTCTCAAGGAAGATGTGCCAGGAGGAACAGACCAGC
TACATGGTGGTGCAGACGAGCGAGGAGGGGCTGGCGGCTGACGCCGAGCTCCCGGGACCGCTCCTGATG
CTGGCCCAGAACTGCGCAGTCATGCACAACCTGCTGGGCCCTGCCTGCATTTTCCTGCGCAAGGGCTTC
GCTGAGAACAGGCAGCCTGATAGATCACTGCGACCAGAGGAAATTGAAGAGCTCCGAGAGGCCTTCAGA
GAATTCGACAAGGACAAGGATGGCTACATCAACTGCCGGGATCTGGGCAACTGCATGCGCACCATGGGC
TACATGCCCACCGAGATGGAGCTCATCGAACTGTCCCAGCAGATCAACATGAACCTGGGTGGCCATGTA
GATTTTGATGACTTCGTGGAGCTAATGGGGCCTAAACTCCTGGCAGAGACAGCAGATATGATTGGTGTA
AAGGAACTGCGAGATGCTTTCCGAGAGTTTGACACCAATGGTGATGGGGAAATAAGCACCAGTGAGCTG
CGAGAGGCTATGAGGAAGCTCCTGGGTCATCAGGTGGGACACCGAGACATAGAGGAAATTATCCGAGAT
GTGGACCTCAATGGGGATGGACGAGTGGACTTTGAAGAGTTTGTCCGGATGATGTCCCGCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_031205
Insert Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_031205.3
RefSeq Size 1262 bp
RefSeq ORF 684 bp
Locus ID 9478
UniProt ID Q9NZU7
Cytogenetics 12q24.31
Domains EFh
MW 26 kDa
Summary Calcium binding proteins are an important component of calcium mediated cellular signal transduction. This gene encodes a protein that belongs to a subfamily of calcium binding proteins which share similarity to calmodulin. The protein encoded by this gene regulates the gating of voltage-gated calcium ion channels. This protein inhibits calcium-dependent inactivation and supports calcium-dependent facilitation of ion channels containing voltage-dependent L-type calcium channel subunit alpha-1C. This protein also regulates calcium-dependent activity of inositol 1,4,5-triphosphate receptors, P/Q-type voltage-gated calcium channels, and transient receptor potential channel TRPC5. This gene is predominantly expressed in retina and brain. Alternative splicing results in multiple transcript variants encoding disinct isoforms. provided by RefSeq, Jul 2012
Transcript Variant: This variant (1) has an alternate 5' sequence, as compared to variant 3. The encoded isoform 1 has a distinct and shorter N-terminus, as compared to isoform 3.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_031205" in other vectors (4)
SKU Description Size Price
RC218317 CABP1 (Myc-DDK-tagged)-Human calcium binding protein 1 (CABP1), transcript variant 1 10 ug
$300.00
RC218317L3 Lenti ORF clone of Human calcium binding protein 1 (CABP1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC218317L4 Lenti ORF clone of Human calcium binding protein 1 (CABP1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG218317 CABP1 (tGFP-tagged) - Human calcium binding protein 1 (CABP1), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products