OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

H2BC6 (NM_003523) Human Untagged Clone

Be the first to review this product
SKU
SC309007
HIST1H2BE (untagged)-Human histone cluster 1, H2be (HIST1H2BE)
  $165.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "H2BC6 or NM_003523"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol H2BC6
Synonyms dJ221C16.8; H2B.h; H2B/h; H2BC4; H2BC7; H2BC8; H2BC10; H2BFH; HIST1H2BE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC309007 representing NM_003523.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTGAGCCAGCGAAATCCGCTCCCGCCCCGAAGAAGGGCTCCAAGAAGGCCGTGACCAAGGCGCAG
AAGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCCGTATACGTGTACAAGGTGCTG
AAACAGGTCCACCCCGACACCGGCATCTCCTCTAAAGCCATGGGGATCATGAATTCCTTTGTCAACGAC
ATCTTCGAGCGCATCGCCGGCGAGGCTTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACCTCC
AGGGAGATCCAGACGGCCGTGCGCCTGCTGCTTCCCGGGGAGCTGGCCAAGCACGCTGTGTCAGAGGGC
ACCAAGGCCGTTACCAAGTACACCAGCTCCAAGTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_003523
Insert Size 381 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003523.2
RefSeq Size 435 bp
RefSeq ORF 381 bp
Locus ID 8344
UniProt ID P62807
Cytogenetics 6p22.2
Protein Pathways Systemic lupus erythematosus
MW 13.9 kDa
Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. The protein has antibacterial and antifungal antimicrobial activity. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. provided by RefSeq, Aug 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_003523" in other vectors (6)
SKU Description Size Price
RC211007 HIST1H2BE (Myc-DDK-tagged)-Human histone cluster 1, H2be (HIST1H2BE) 10 ug
$150.00
RC211007L1 Lenti ORF clone of Human histone cluster 1, H2be (HIST1H2BE), Myc-DDK-tagged 10 ug
$450.00
RC211007L2 Lenti ORF clone of Human histone cluster 1, H2be (HIST1H2BE), mGFP tagged 10 ug
$450.00
RC211007L3 Lenti ORF clone of Human histone cluster 1, H2be (HIST1H2BE), Myc-DDK-tagged 10 ug
$450.00
RC211007L4 Lenti ORF clone of Human histone cluster 1, H2be (HIST1H2BE), mGFP tagged 10 ug
$450.00
RG211007 HIST1H2BE (tGFP-tagged) - Human histone cluster 1, H2be (HIST1H2BE) 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products