OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SR1 (SRI) (NM_198901) Human Untagged Clone

Be the first to review this product
SKU
SC307807
SRI (untagged)-Human sorcin (SRI), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA382002 SRI Rabbit polyclonal Antibody
100 ul
$475.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SR1 or NM_198901"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SR1
Synonyms CP-22; CP22; SCN; V19
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_198901 edited
ATGCAGTATGGAGGGGCTCCCGGAGGGCCTGCGTTTCCCGGACAAACTCAGGATCCGCTG
TATGGTTACTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAG
AGATGTCTGACACAGTCTGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACTTGC
CGGCTTATGGTTTCAATGCTGGATAGAGATATGTCTGGCACAATGGGTTTCAATGAATTT
AAAGAACTCTGGGCTGTACTGAATGGCTGGAGACAACACTTTATCAGTTTTGACACTGAC
AGGAGTGGAACAGTAGACCCACAAGAATTGCAGAAGGCCCTGACAACAATGGGATTTAGG
TTGAGTCCCCAGGCTGTGAATTCAATTGCAAAACGATACAGCACCAATGGAAAGATCACC
TTCGACGACTACATCGCCTGCTGCGTCAAACTGAGGGCTCTTACAGACAGCTTTCGAAGA
CGGGATACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAATGTGTC
ATGAGTGTTTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_198901 unedited
NGGCGCGTTCNAATTTGTATACGACTCATATAGGCGGCCGCGNATTCCCGAAAAGCAGTA
TGGAGGGGCTCCCGGNAGGCCTGCGTTTCCCGGACAAACTCAGGATCCGCTGTATGGTTA
CTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATGTCT
GACACAGTCTGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACTTGCCGGCTTAT
GGTTTCAATGCTGGATAGAGATATGTCTGGCACAATGGGTTTCAATGAATTTAAAGAACT
CTGGGCTGTACTGAATGGCTGGAGACAACACTTTATCAGTTTTGACACTGACAGGAGTGG
AACAGTAGACCCACAAGAATTGCAGAAGGCCCTGACAACAATGGGATTTAGGTTGAGTCC
CCAGGCTGTGAATTCAATTGCAAAACGATACAGCACCAATGGAAAGATCACCTTCGACGA
CTACATCGCCTGCTGCGTCAAACTGAGGGCTCTTACAGACAGCTTTCGAAGACGGGATAC
TGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAATGTGTCATGAGTGT
TTAAATCAAGAGGAAGCTGCATGAATGTAATCAACATTCCAACTGGAGCTCTCCTTTGCT
TGTCCTCTTTGCCTTCGGTAATATGTATAAACTTACATCACGACTTTCTCTTAACAGCTG
TTGTAAAGTTTATTACTTTATGTACAACTGAAGTTTTGTTTTAGTTTTGATAATAAATTC
TTTGGAACTTTAATAAGATCTAGTCTGTTACACCATTTAGAACTTTCCTGAGCCATTATC
AGTCATGCCTTATTTTCTTGCTAAAACA
Restriction Sites Please inquire |
ACCN NM_198901
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198901.1, NP_944490.1
RefSeq Size 2012 bp
RefSeq ORF 552 bp
Locus ID 6717
UniProt ID P30626
Cytogenetics 7q21.12
Protein Families Druggable Genome
Summary This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. provided by RefSeq, Mar 2012
Transcript Variant: This variant (2) differs in the 5' UTR and coding region and uses an alternate translational start codon, compared to variant 1. These differences result in a protein (isoform B) with a shorter and distinct N-terminus, compared to isoform A.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_198901" in other vectors (6)
SKU Description Size Price
RC222838 SRI (Myc-DDK-tagged)-Human sorcin (SRI), transcript variant 2 10 ug
$450.00
RC222838L1 Lenti ORF clone of Human sorcin (SRI), transcript variant 2, Myc-DDK-tagged 10 ug
$750.00
RC222838L2 Lenti ORF clone of Human sorcin (SRI), transcript variant 2, mGFP tagged 10 ug
$750.00
RC222838L3 Lenti ORF clone of Human sorcin (SRI), transcript variant 2, Myc-DDK-tagged 10 ug
$750.00
RC222838L4 Lenti ORF clone of Human sorcin (SRI), transcript variant 2, mGFP tagged 10 ug
$750.00
RG222838 SRI (tGFP-tagged) - Human sorcin (SRI), transcript variant 2 10 ug
$650.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products