OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

NF2 (NM_181831) Human Untagged Clone

Be the first to review this product
SKU
SC307382
NF2 (untagged)-Human neurofibromin 2 (merlin) (NF2), transcript variant 13
  $520.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA379069 NF2 Rabbit polyclonal Antibody
100 ul
$475.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "NF2 or NM_181831"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NF2
Synonyms ACN; BANF; merlin-1; SCH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307382 representing NM_181831.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGGGGCCATCGCTTCCCGCATGAGCTTCAGCTCTCTCAAGAGGAAGCAACCCAAGACGTTCACC
GTGAGGATCGTCACCATGGACGCCGAGATGGAGTTCAATTGCGAGGTAAAGAAGCAGATTTTAGATGAA
AAGATCTACTGCCCTCCTGAGGCTTCTGTGCTCCTGGCTTCTTACGCCGTCCAGGCCAAGTATGGTGAC
TACGACCCCAGTGTTCACAAGCGGGGATTTTTGGCCCAAGAGGAATTGCTTCCAAAAAGGGTAATAAAT
CTGTATCAGATGACTCCGGAAATGTGGGAGGAGAGAATTACTGCTTGGTACGCAGAGCACCGAGGCCGA
GCCAGGGATGAAGCTGAAATGGAATATCTGAAGATAGCTCAGGACCTGGAGATGTACGGTGTGAACTAC
TTTGCAATCCGGAATAAAAAGGGCACAGAGCTGCTGCTTGGAGTGGATGCCCTGGGGCTTCACATTTAT
GACCCTGAGAACAGACTGACCCCCAAGATCTCCTTCCCGTGGAATGAAATCCGAAACATCTCGTACAGT
GACAAGGAGTTTACTATTAAACCACTGGATAAGAAAATTGATGTCTTCAAGTTTAACTCCTCAAAGCTT
CGTGTTAATAAGCTGATTCTCCAGCTATGTATCGGGAACCATGATCTATTTATGAGGAGAAGGAAAGCC
GATTCTTTGGAAGTTCAGCAGATGAAAGCCCAGGCCAGGGAGGAGAAGGCTAGAAAGCAGATGGAGCGG
CAGCGCCTCGCTCGAGAGAAGCAGATGAGGGAGGAGGCTGAACGCACGAGGGATGAGTTGGAGAGGAGG
CTGCTGCAGATGAAAGAAGAAGCAACAATGGCCAACGAAGCACTGATGCGGTCTGAGGAGACAGCTGAC
CTGTTGGCTGAAAAGGCCCAGATCACCGAGGAGGAGGCAAAACTTCTGGCCCAGAAGGCCGCAGAGGCT
GAGCAGGAAATGCAGCGCATCAAGGCCACAGCGATTCGCACGGAGGAGGAGAAGCGCCTGATGGAGCAG
AAGGTGCTGGAAGCCGAGGTGCTGGCACTGAAGATGGCTGAGGAGTCAGAGAGGAGGGCCAAAGAGGCA
GATCAGCTGAAGCAGGACCTGCAGGAAGCACGCGAGGCGGAGCGAAGAGCCAAGCAGAAGCTCCTGGAG
ATTGCCACCAAGCCCACGTACCCGCCCATGAACCCAATTCCAGCACCGTTGCCTCCTGACATACCAAGC
TTCAACCTCATTGGTGACAGCCTGTCTTTCGACTTCAAAGATACTGACATGAAGCGGCTTTCCATGGAG
ATAGAGAAAGAAAAAGTGGAATACATGGAAAAGAGCAAGCATCTGCAGGAGCAGCTCAATGAACTCAAG
ACAGAAATCGAGGCCTTGAAACTGAAAGAGAGGGAGACAGCTCTGGATATTCTGCACAATGAGAACTCC
GACAGGGGTGGCAGCAGCAAGCACAATACCATTAAAAAGCCTCAAGCCCAAGGCAGAAGACCTATCTGC
ATTTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_181831
Insert Size 1524 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181831.2
RefSeq Size 2217 bp
RefSeq ORF 1524 bp
Locus ID 4771
UniProt ID P35240
Cytogenetics 22q12.2
Protein Families Druggable Genome
MW 59.1 kDa
Summary This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that are thought to link cytoskeletal components with proteins in the cell membrane. This gene product has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics and proteins involved in regulating ion transport. This gene is expressed at high levels during embryonic development; in adults, significant expression is found in Schwann cells, meningeal cells, lens and nerve. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. Two predominant isoforms and a number of minor isoforms are produced by alternatively spliced transcripts. provided by RefSeq, Jul 2008
Transcript Variant: This variant (13) lacks two alternate in-frame exons in the 5' coding region and differs in the 3' coding region and UTR, compared to variant 1. The resulting protein (isoform 7, also referred to as isoform delE2/3) is shorter and has a distinct C-terminus, compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_181831" in other vectors (4)
SKU Description Size Price
RC222487 NF2 (Myc-DDK-tagged)-Human neurofibromin 2 (merlin) (NF2), transcript variant 13 10 ug
$472.00
RC222487L3 Lenti ORF clone of Human neurofibromin 2 (merlin) (NF2), transcript variant 13, Myc-DDK-tagged 10 ug
$772.00
RC222487L4 Lenti ORF clone of Human neurofibromin 2 (merlin) (NF2), transcript variant 13, mGFP tagged 10 ug
$772.00
RG222487 NF2 (tGFP-tagged) - Human neurofibromin 2 (merlin) (NF2), transcript variant 13 10 ug
$672.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products