OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PILRB (NM_178238) Human Untagged Clone

Be the first to review this product
SKU
SC307145
PILRB (untagged)-Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 3
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA350285 Rabbit Polyclonal Anti-PILRB Antibody
100 ul
$205.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PILRB or NM_178238"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PILRB
Synonyms FDFACT1; FDFACT2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307145 representing NM_178238.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTCGGCCCCTGCTGCTGCCCCTGCTGCTCCTGCTGCAGCCGCCAGCATTTCTGCAGCCTGGTGGC
TCCACAGGATCTGGTCCAAGCTACCTTTATGGGGTCACTCAACCAAAACACCTCTCAGCCTCCATGGGT
GGCTCTGTGGAAATCCCCTTCTCCTTCTATTACCCCTGGGAGTTAGCCATAGTTCCCAACGTGAGAATA
TCCTGGAGACGGGGCCACTTCCACGGGCAGTCCTTCTACAGCACAAGGCCGCCTTCCATTCACAAGGAT
TATGTGAACCGGCTCTTTCTGAACTGGACAGAGGGTCAGGAGAGCGGCTTCCTCAGGATCTCAAACCTG
CGGAAGGAGGACCAGTCTGTGTATTTCTGCCGAGTCGAGCTGGACACCCGGAGATCAGGGAGGCAGCAG
TTGCAGTCCATCAAGGGGACCAAACTCACCATCACCCAGGCTGTCACAACCACCACCACCTGGAGGCCC
AGCAGCACAACCACCATAGCCGGCCTCAGGGTCACAGAAAGCAAAGGGCACTCAGAATCATGGCACCTA
AGTCTGGACACTGCCATCAGGGTTGCATTGGCTGTCGCTGTGCTCAAAACTGTCATTTTGGGACTGCTG
TGCCTCCTCCTCCTGTGGTGGAGGAGAAGGAAAGGTAGCAGGGCGCCAAGCAGTGACTTCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_178238
Insert Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_178238.3
RefSeq Size 1438 bp
RefSeq ORF 684 bp
Locus ID 29990
UniProt ID Q9UKJ0
Cytogenetics 7q22.1
Protein Families Druggable Genome, Transmembrane
MW 25.5 kDa
Summary The paired immunoglobin-like type 2 receptors consist of highly related activating and inhibitory receptors that are involved in the regulation of many aspects of the immune system. The paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This gene encodes the activating member of the receptor pair and contains a truncated cytoplasmic tail relative to its inhibitory counterpart (PILRA), that has a long cytoplasmic tail with immunoreceptor tyrosine-based inhibitory (ITIM) motifs. This gene is thought to have arisen from a duplication of the inhibitory PILRA gene and evolved to acquire its activating function. provided by RefSeq, Jun 2013
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_178238" in other vectors (4)
SKU Description Size Price
RC222631 PILRB (Myc-DDK-tagged)-Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 3 10 ug
$300.00
RC222631L3 Lenti ORF clone of Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC222631L4 Lenti ORF clone of Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 3, mGFP tagged 10 ug
$600.00
RG222631 PILRB (tGFP-tagged) - Human paired immunoglobin-like type 2 receptor beta (PILRB), transcript variant 3 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products