OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

KCNMB3 (NM_171830) Human Untagged Clone

Be the first to review this product
SKU
SC306700
KCNMB3 (untagged)-Human potassium large conductance calcium-activated channel, subfamily M beta member 3 (KCNMB3), transcript variant 3
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA351321 Rabbit Polyclonal Anti-KCNMB3 Antibody
100 ul
$205.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "KCNMB3 or NM_171830"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KCNMB3
Synonyms BKBETA3; HBETA3; K(VCA)BETA-3; KCNMB2; KCNMBL; SLO-BETA-3; SLOBETA3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC306700 representing NM_171830.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCCCCCTTCTTTATGAGCTCACTGCAGTATCTCCTTCTCCCTTTCCCCAAAGGACAGCCTTTCCT
GCCTCAGGGAAGAAGAGAGAGACAGACTACAGTGATGGAGACCCACTAGATGTGCACAAGAGGCTGCCA
TCCAGTGCTGGAGAGGACCGAGCCGTGATGCTGGGGTTTGCCATGATGGGCTTCTCAGTCCTAATGTTC
TTCTTGCTCGGAACAACCATTCTAAAGCCTTTTATGCTCAGCATTCAGAGAGAAGAATCGACCTGCACT
GCCATCCACACAGATATCATGGACGACTGGCTGGACTGTGCCTTCACCTGTGGTGTGCACTGCCACGGT
CAGGGGAAGTACCCGTGTCTTCAGGTGTTTGTGAACCTCAGCCATCCAGGTCAGAAAGCTCTCCTACAT
TATAATGAAGAGGCTGTCCAGATAAATCCCAAGTGCTTTTACACACCTAAGTGCCACCAAGATAGAAAT
GATTTGCTCAACAGTGCTCTGGACATAAAAGAATTCTTCGATCACAAAAATGGAACCCCCTTTTCATGC
TTCTACAGTCCAGCCAGCCAATCTGAAGATGTCATTCTTATAAAAAAGTATGACCAAATGGCTATCTTC
CACTGTTTATTTTGGCCTTCACTGACTCTGCTAGGTGGTGCCCTGATTGTTGGCATGGTGAGATTAACA
CAACACCTGTCCTTACTGTGTGAAAAATATAGCACTGTAGTCAGAGATGAGGTAGGTGGAAAAGTACCT
TATATAGAACAGCATCAGTTCAAACTGTGCATTATGAGGAGGAGCAAAGGAAGAGCAGAGAAATCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_171830
Insert Size 828 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_171830.1
RefSeq Size 1835 bp
RefSeq ORF 828 bp
Locus ID 27094
UniProt ID Q9NPA1
Cytogenetics 3q26.32
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Protein Pathways Vascular smooth muscle contraction
MW 31.1 kDa
Summary MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which may partially inactivate or slightly decrease the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 22. provided by RefSeq, Jul 2009
Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, and uses an alternate translational start codon, compared to variant 4. The resulting isoform (c) has a distinct N-terminus and is shorter than isoform d. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_171830" in other vectors (4)
SKU Description Size Price
RC222739 KCNMB3 (Myc-DDK-tagged)-Human potassium large conductance calcium-activated channel, subfamily M beta member 3 (KCNMB3), transcript variant 3 10 ug
$300.00
RC222739L3 Lenti ORF clone of Human potassium large conductance calcium-activated channel, subfamily M beta member 3 (KCNMB3), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC222739L4 Lenti ORF clone of Human potassium large conductance calcium-activated channel, subfamily M beta member 3 (KCNMB3), transcript variant 3, mGFP tagged 10 ug
$600.00
RG222739 KCNMB3 (tGFP-tagged) - Human potassium large conductance calcium-activated channel, subfamily M beta member 3 (KCNMB3), transcript variant 3 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products