OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MLX (NM_170607) Human Untagged Clone

Be the first to review this product
SKU
SC306675
MLX (untagged)-Human MAX-like protein X (MLX), transcript variant 3
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA810951 MLX mouse monoclonal antibody,clone OTI1D11 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MLX or NM_170607"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MLX
Synonyms bHLHd13; MAD7; MXD7; TCFL4; TF4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_170607 edited
CCGGTGGGTACAAGATGACGGAGCCGGGCGCCTCTCCCGAGGACCCTTGGGTCAAGGCAA
GCCCCGTGGGCGCGCACGCCGGCGAGGGGAGGGCGGGTCGGGCTCGTGCACGTAGGGGGG
CCGGAAGACGAGGGGCTTCCCTCCTGTCCCCAAAGTCCCCCACGCTCTCCGTGCCCCGGG
GCTGCAGAGAAGACAGCTCTCACCCCGCGTGTGCCAAGGTGGAGTATGCCTACAGCGACA
ACAGCCTGGACCCCGGGCTTTTTGTAGAAAGCACCCGCAAGGGGAGTGTAGTGTCCAGAG
CTAATAGCATCGGTTCCACCAGTGCCTCTTCTGTCCCCAACACAGATGATGAGGACAGTG
ATTACCACCAGGAGGCCTACAAGGAGTCCTACAAAGACCGGCGGCGGCGCGCACACACTC
AGGCTGAGCAGAAGAGGAGGGACGCCATCAAGAGAGGCTATGATGACCTTCAGACCATCG
TCCCCACTTGCCAGCAGCAGGACTTCTCCATTGGCTCCCAAAAGCTCAGCAAAGCCATCG
TTCTACAAAAGACCATTGACTACATTCAGTTTTTGCACAAGGAGAAGAAAAAGCAGGAGG
AGGAGGTGTCCACGTTACGCAAGGATGTCACCGCCCTAAAGATCATGAAAGTGAACTATG
AGCAGATTGTGAAGGCACACCAGGACAACCCCCATGAAGGGGAGGACCAGGTCTCTGACC
AGGTCAAGTTCAACGTGTTTCAAGGCATCATGGATTCCCTGTTCCAGTCCTTCAATGCCT
CCATCTCAGTGGCCAGCTTCCAGGAGCTGTCAGCATGTGTCTTCAGCTGGATCGAGGAGC
ACTGTAAGCCTCAGACCCTGCGGGAGATTGTGATTGGCGTCCTGCACCAATTGAAAAACC
AGCTTTACTGA
Restriction Sites Please inquire |
ACCN NM_170607
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found the protein coded by this clone is identical to NM_170607.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_170607.2, NP_733752.1
RefSeq Size 2568 bp
RefSeq ORF 897 bp
Locus ID 6945
UniProt ID Q9UH92
Cytogenetics 17q21.2
Protein Families Druggable Genome, Transcription Factors
Summary The product of this gene belongs to the family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors. These factors form heterodimers with Mad proteins and play a role in proliferation, determination and differentiation. This gene product may act to diversify Mad family function by its restricted association with a subset of the Mad family of transcriptional repressors, namely, Mad1 and Mad4. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (3) contains two additional segments in the coding region compared to variant 1. The resulting isoform (gamma) thus, is longer than isoform alpha encoded by variant 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_170607" in other vectors (6)
SKU Description Size Price
RC224283 MLX (Myc-DDK-tagged)-Human MAX-like protein X (MLX), transcript variant 3 10 ug
$300.00
RC224283L1 Lenti ORF clone of Human MAX-like protein X (MLX), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC224283L2 Lenti ORF clone of Human MAX-like protein X (MLX), transcript variant 3, mGFP tagged 10 ug
$600.00
RC224283L3 Lenti ORF clone of Human MAX-like protein X (MLX), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC224283L4 Lenti ORF clone of Human MAX-like protein X (MLX), transcript variant 3, mGFP tagged 10 ug
$600.00
RG224283 MLX (tGFP-tagged) - Human MAX-like protein X (MLX), transcript variant 3 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products