OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

WNT3A (NM_033131) Human Untagged Clone

Be the first to review this product
SKU
SC305570
WNT3A (untagged)-Human wingless-type MMTV integration site family, member 3A (WNT3A)
  $686.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA592927 WNT3A Rabbit monoclonal antibody,clone OTIR4G6
100 ul
$519.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "WNT3A or NM_033131"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol WNT3A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_033131 edited
ACGCTCTCGGGGCGGACTCCCGGCCCTCCGCGCCCTCTCGCGCGGCGATGGCCCCACTCG
GATACTTCTTACTCCTCTGCAGCCTGAAGCAGGCTCTGGGCAGCTACCCGATCTGGTGGT
CGCTGGCTGTTGGGCCACAGTATTCCTCCCTGGGCTCGCAGCCCATCCTGTGTGCCAGCA
TCCCGGGCCTGGTCCCCAAGCAGCTCCGCTTCTGCAGGAACTACGTGGAGATCATGCCCA
GCGTGGCCGAGGGCATCAAGATTGGCATCCAGGAGTGCCAGCACCAGTTCCGCGGCCGCC
GGTGGAACTGCACCACCGTCCACGACAGCCTGGCCATCTTCGGGCCCGTGCTGGACAAAG
CTACCAGGGAGTCGGCCTTTGTCCACGCCATTGCCTCAGCCGGTGTGGCCTTTGCAGTGA
CACGCTCATGTGCAGAAGGCACGGCCGCCATCTGTGGCTGCAGCAGCCGCCACCAGGGCT
CACCAGGCAAGGGCTGGAAGTGGGGTGGCTGTAGCGAGGACATCGAGTTTGGTGGGATGG
TGTCTCGGGAGTTCGCCGACGCCCGGGAGAACCGGCCAGATGCCCGCTCAGCCATGAACC
GCCACAACAACGAGGCTGGGCGCCAGGCCATCGCCAGCCACATGCACCTCAAGTGCAAGT
GCCACGGGCTGTCGGGCAGCTGCGAGGTGAAGACATGCTGGTGGTCGCAACCCGACTTCC
GCGCCATCGGTGACTTCCTCAAGGACAAGTACGACAGCGCCTCGGAGATGGTGGTGGAGA
AGCACCGGGAGTCCCGCGGCTGGGTGGAGACCCTGCGGCCGCGCTACACCTACTTCAAGG
TGCCCACGGAGCGCGACCTGGTCTACTACGAGGCCTCGCCCAACTTCTGCGAGCCCAACC
CTGAGACGGGCTCCTTCGGCACGCGCGACCGCACCTGCAACGTCAGCTCGCACGGCATCG
ACGGCTGCGACCTGCTGTGCTGCGGCCGCGGCCACAACGCGCGAGCGGAGCGGCGCCGGG
AGAAGTGCCGCTGCGTGTTCCACTGGTGCTGCTACGTCAGCTGCCAGGAGTGCACGCGCG
TCTACGACGTGCACACCTGCAAGTAGGCACCGGCCGCGGCTCCCCCTGGACGGGGCGGGC
CCTGCCTGAGGGTGGGCTTTTCCCTGGGTGGAGCAGGACTCCCACCTAAACGGGGCAGTA
CTCCTCCCTGGGGGCGGGACTCCTACCTGGGGAAAGCCTGAAGGAGAAAACA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_033131 unedited
GTTCGGCATTNTGTATACGACTCATATAGGGCGGCCGCGATTCAGATCTGGTACCGAGCT
CGGATCCACTAGTAACGGCCGCCATGTGCTGGAATTCGCCCTTCACCACGCTCTCGGGGC
GGACTCCCGGCCCTCCGCGCCCTCTCGCGCGGCGATGGCCCCACTCGGATACTTCTTACT
CCTCTGCAGCCTGAAGCAGGCTCTGGGCAGCTACCCGATCTGGTGGTCGCTGGCTGTTGG
GCCACAGTATTCCTCCCTGGGCTCGCAGCCCATCCTGTGTGCCAGCATCCCGGGCCTGGT
CCCCAAGCAGCTCCGCTTCTGCAGGAACTACGTGGAGATCATGCCCAGCGTGGCCGAGGG
CATCAAGATTGGCATCCAGGAGTGCCAGCACCAGTTCCGCGGCCGCCGGTGGAACTGCAC
CACCGTCCACGACAGCCTGGCCATCTTCGGGCCCGTGCTGGACAAAGCTACCAGGGAGTC
GGCCTTTGTCCACGCCATTGCCTCAGCCGGTGTGGCCTTTGCAGTGACACGCTCATGTGC
AGAAGGCACGGCCGCCATCTGTGGCTGCAGCAGCCGCCACCAGGGCTCACCAGGCAAGGG
CTGGAAGTGGGGTGGCTGTAGCGAGGACATCGAGTTTGGTGGGATGGTGTCTCGGGAGTT
CGCCGACGCCCGGGAGAAACCGCCAGATGCCCGCTCAGCCATGAACCGNCACAACAACGA
GGCTGGGCGCCAGGCCATCGNCAGCCACATGCACCTCAAGTGCAAGTGCCACGGGCTGTC
GGGCAGCTGCGAGGTGAAGACATGCTGGGTGGTCGCAACCCCGACTTCCGCGCCATCGC
Restriction Sites Please inquire |
ACCN NM_033131
Insert Size 1300 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_033131.2, NP_149122.1
RefSeq Size 2932 bp
RefSeq ORF 1059 bp
Locus ID 89780
UniProt ID P56704
Cytogenetics 1q42.13
Protein Families Adult stem cells, Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Stem cell relevant signaling - Wnt Signaling pathway
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
Summary The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 96% amino acid identity to mouse Wnt3A protein, and 84% to human WNT3 protein, another WNT gene product. This gene is clustered with WNT14 gene, another family member, in chromosome 1q42 region. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_033131" in other vectors (6)
SKU Description Size Price
RC213639 WNT3A (Myc-DDK-tagged)-Human wingless-type MMTV integration site family, member 3A (WNT3A) 10 ug
$457.00
RC213639L1 Lenti ORF clone of Human wingless-type MMTV integration site family, member 3A (WNT3A), Myc-DDK-tagged 10 ug
$757.00
RC213639L2 Lenti ORF clone of Human wingless-type MMTV integration site family, member 3A (WNT3A), mGFP tagged 10 ug
$757.00
RC213639L3 Lenti ORF clone of Human wingless-type MMTV integration site family, member 3A (WNT3A), Myc-DDK-tagged 10 ug
$757.00
RC213639L4 Lenti ORF clone of Human wingless-type MMTV integration site family, member 3A (WNT3A), mGFP tagged 10 ug
$757.00
RG213639 WNT3A (tGFP-tagged) - Human wingless-type MMTV integration site family, member 3A (WNT3A) 10 ug
$489.00 $657.00

file-alt Citations

Identification and characterization of a small-molecule inhibitor of Wnt signaling in glioblastoma cells
De Robertis, Valensin, Rossi et al
Mol. Cancer Ther. (2013) 12 (7), 1180-9 DOI: 10.1158/1535-7163.MCT-12-1176-T
Cited by 1
AI Summary: OriGene contributed "transfection ready" human AXIN1 and WNT3A plasmids, which were used in the study to investigate the effects of Wnt signaling modulation in glioblastoma cells.
Snippet: restriction enzymes Mlu1 and BamH1 and ligated by T4-Ligase to form the final construct. Human AXIN1 and WNT3A were purchased from Origene as “transfection ready” plasmids. Dominant negative TCF4 cDNA was purchased from Upstate. Human LRP6 and WNT1 have
Characterization of the interaction of sclerostin with the low density lipoprotein receptor-related protein (LRP) family of Wnt co-receptors
Holdsworth, Slocombe, Doyle et al
J. Biol. Chem. (2012) 287 (32), 26464-77 DOI: 10.1074/jbc.M112.350108
Cited by 9
AI Summary: OriGene contributed full-length human cDNA clones for Wnt1, Wnt3A, Wnt9B, sclerostin, LRP4, LRP5, LRP6, and MESD, which were essential for the expression and characterization of these proteins in the study.
Snippet: Full-length human cDNA clones encoding human Wnt1, Wnt3A, Wnt9B, sclerostin, LRP4, LRP5, LRP6, and MESD were obtained from Origene. ... Fig. 4 shows that a series of the peptides (including some very short peptides) that were active in the FRET assay also inhibited the
Effects of a glycogen synthase kinase-3β inhibitor (LiCl) on c-myc protein in intervertebral disc cells
Hiyama, Sakai, Arai et al
J. Cell. Biochem. (2011) 112 (10), 2974-86 DOI: 10.1002/jcb.23217
Cited by 35
AI Summary: OriGene contributed to this study by providing the Wnt3a plasmid (sc-305570) and the backbone plasmid (pCMV6XL5), which were used to investigate the regulation of c-myc expression by Wnt signaling in intervertebral disc cells.
Snippet: www.cbil.upenn.edu/cgi-bin/tess/tess). The plasmid for Wnt3a (sc-305570) and the backbone plasmid (pCMV6XL5) were provided by OriGene (Rockville, MD). The luciferase reporter plasmid encoding the aggrecan promoter
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products