PRDM12 (NM_021619) Human Untagged Clone

SKU
SC304945
PRDM12 (untagged)-Human PR domain containing 12 (PRDM12)
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PRDM12
Synonyms HSAN8; PFM9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC304945 representing NM_021619.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGGGCTCCGTGCTCCCGGCTGAGGCCCTGGTGCTCAAGACCGGGCTGAAGGCGCCGGGACTGGCG
CTGGCCGAGGTTATCACCTCCGACATCCTGCACAGCTTCCTGTACGGCCGCTGGCGCAACGTGCTCGGG
GAGCAGCTCTTCGAGGACAAGAGCCACCACGCCAGCCCCAAGACAGCCTTCACCGCCGAGGTGCTGGCG
CAGTCCTTCTCCGGCGAAGTGCAGAAGCTGTCCAGCCTGGTGCTGCCTGCGGAGGTGATCATCGCTCAG
AGCTCCATCCCTGGCGAGGGCCTCGGCATCTTCTCCAAGACGTGGATCAAGGCGGGAACCGAGATGGGC
CCCTTCACCGGCCGCGTGATCGCCCCGGAGCACGTGGACATCTGCAAGAACAACAACCTCATGTGGGAG
GTGTTCAATGAGGATGGCACGGTGCGCTACTTCATCGATGCCAGCCAGGAGGACCACCGGAGCTGGATG
ACCTACATCAAGTGTGCACGTAACGAACAGGAGCAGAACCTGGAGGTGGTCCAGATCGGCACCAGCATC
TTCTACAAGGCCATTGAGATGATCCCACCTGACCAGGAACTGCTGGTGTGGTACGGAAACTCACACAAC
ACCTTCCTGGGGATCCCAGGTGTGCCCGGGCTAGAGGAGGACCAGAAAAAGAACAAGCATGAGGACTTC
CACCCGGCGGACTCGGCGGCTGGCCCCGCGGGCCGCATGCGATGCGTCATCTGCCACCGCGGCTTCAAC
TCGCGCAGCAACCTGCGCTCGCACATGCGCATCCACACGCTGGACAAGCCCTTCGTGTGCCGCTTCTGC
AACCGCCGCTTCAGCCAGTCGTCCACGCTGCGCAACCACGTGCGCCTGCACACGGGCGAGCGCCCCTAC
AAGTGCCAGGTGTGCCAGAGCGCCTACTCGCAGCTGGCCGGCCTGCGCGCCCACCAGAAGAGCGCGCGG
CACCGGCCGCCCAGCACCGCGCTGCAGGCACACTCGCCCGCGCTGCCCGCCCCGCACGCGCACGCGCCC
GCGCTCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCGCACCACCTGCCGGCCATGGTGCTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_021619
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_021619.2
RefSeq Size 2492 bp
RefSeq ORF 1104 bp
Locus ID 59335
UniProt ID Q9H4Q4
Cytogenetics 9q34.12
MW 40.4 kDa
Summary This gene encodes a transcriptional regulator of sensory neuronal specification that plays a critical role in pain perception. The encoded protein contains an N-terminal PRDI-BF1 and RIZ homology (PR) domain, a SET domain, and three C-terminal C2H2 zinc finger DNA-binding domains. Naturally occurring mutations in this gene are associated with congenital insensitivity to pain (CIP), and hereditary sensory and autonomic neuropathies (HSAN's) affecting peripheral sensory and autonomic neurons. Deregulation of this gene is associated with solid cancers and hematological malignancies including chronic myeloid leukaemia. [provided by RefSeq, Mar 2017]
Write Your Own Review
You're reviewing:PRDM12 (NM_021619) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211434 PRDM12 (Myc-DDK-tagged)-Human PR domain containing 12 (PRDM12) 10 ug
$457.00
RC211434L1 Lenti ORF clone of Human PR domain containing 12 (PRDM12), Myc-DDK-tagged 10 ug
$757.00
RC211434L2 Lenti ORF clone of Human PR domain containing 12 (PRDM12), mGFP tagged 10 ug
$757.00
RC211434L3 Lenti ORF clone of Human PR domain containing 12 (PRDM12), Myc-DDK-tagged 10 ug
$757.00
RC211434L4 Lenti ORF clone of Human PR domain containing 12 (PRDM12), mGFP tagged 10 ug
$757.00
RG211434 PRDM12 (tGFP-tagged) - Human PR domain containing 12 (PRDM12) 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.