OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

BTNL2 (NM_019602) Human Untagged Clone

Be the first to review this product
SKU
SC304682
BTNL2 (untagged)-Human butyrophilin-like 2 (MHC class II associated) (BTNL2)
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA369598 BTNL2 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "BTNL2 or NM_019602"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BTNL2
Synonyms BTL-II; BTN7; HSBLMHC1; SS2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_019602 edited
ATGGTGGATTTTCCAGGCTACAATCTGTCTGGTGCAGTCGCCTCCTTCCTATTCATCCTG
CTGACAATGAAGCAGTCAGAAGACTTTAGAGTCATTGGCCCTGCTCATCCTATCCTGGCC
GGGGTTGGGGAAGATGCCCTGTTAACCTGCCAGCTACTCCCCAAGAGGACCACAATGCAC
GTGGAGGTGAGGTGGTACCGCTCAGAGCCCAGCACACCTGTGTTTGTGCACAGGGATGGA
GTGGAGGTGACTGAGATGCAGATGGAGGAGTACAGAGGCTGGGTAGAGTGGATAGAGAAT
GGCATTGCAAAGGGAAATGTGGCACTGAAGATACACAACATCCAGCCCTCCGACAATGGA
CAATACTGGTGCCATTTCCAGGATGGGAACTACTGTGGAGAAACAAGCTTGCTGCTCAAA
GTAGCAGGTCTGGGGTCTGCCCCTAGCATCCACATGGAGGGACCTGGGGAGAGTGGAGTC
CAGCTTGTGTGCACTGCAAGGGGCTGGTTCCCAGAGCCCCAGGTGTATTGGGAAGACATC
CGGGGAGAGAAGCTGCTGGCCGTGTCTGAGCATCGCATCCAAGATAAAGATGGCCTGTTC
TATGCGGAAGCCACCCTGGTGGTCAGGAACGCCTCTGCAGAGTCTGTGTCCTGCTTGGTC
CACAACCCCGTCCTCACTGAGGAGAAGGGGTCGGTCATCAGCCTCCCAGAGAAACTCCAG
ACTGAGCTGGCTTCTTTAAAAGTGAATGGACCTTCCCAGCCCATCCTCGTCAGAGTGGGA
GAAGATATACAGCTAACCTGTTACCTGTCCCCCAAGGCGAATGCACAGAGCATGGAGGTG
AGGTGGGACCGATCCCACCGTTACCCTGCTGTGCATGTGTATATGGATGGGGACCATGTG
GCTGGAGAGCAGATGGCAGAGTACAGAGGGAGGACTGTACTGGTGAGTGACGCCATTGAC
GAGGGCAGACTGACCCTGCAGATACTCAGTGCCAGACCTTCGGACGACGGGCAGTACCGC
TGCCTTTTTGAAAAAGATGATGTCTACCAGGAGGCCAGTTTGGATCTGAAGGTGGTAAGT
CTGGGTTCTTCCCCACTGATCACTGTGGAGGGGCAAGAAGATGGAGAAATGCAGCCGATG
TGCTCTTCAGATGGGTGGTTCCCACAGCCCCACGTGCCATGGAGGGACATGGAAGGAAAG
ACGATACCATCATCTTCCCAGGCCCTGACTCAAGGCAGCCACGGGCTGTTCCACGTGCAG
ACATTGCTAAGGGTCACAAACATCTCCGCTGTGGACGTCACTTGTTCCATCAGCATCCCC
TTTTTGGGCGAGGAGAAAATCGCAACTTTTTCTCTCTCAGGTTGGTGA
Restriction Sites Please inquire |
ACCN NM_019602
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_019602.1, NP_062548.1
RefSeq Size 1368 bp
RefSeq ORF 1368 bp
Locus ID 56244
Cytogenetics 6p21.32
Protein Families Druggable Genome, Secreted Protein
Summary This gene encodes a major histocompatibility complex, class II associated, type I transmembrane protein which belongs to the butyrophilin-like B7 family of immunoregulators. It is thought to be involved in immune surveillance, serving as a negative T-cell regulator by decreasing T-cell proliferation and cytokine release. The encoded protein contains an N-terminal signal peptide, two pairs of immunoglobulin-like domains, separated by a heptad peptide sequence, and a C-terminal transmembrane domain. Naturally occurring mutations in this gene are associated with sarcoidosis, rheumatoid arthritis, ulcerative colitis, inflammatory bowel disease, myositis, type 1 diabetes, systemic lupus erythematosus, acute coronary syndrome, and prostate cancer. provided by RefSeq, May 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_019602" in other vectors (6)
SKU Description Size Price
RC214359 BTNL2 (Myc-DDK-tagged)-Human butyrophilin-like 2 (MHC class II associated) (BTNL2) 10 ug
$686.00
RC214359L1 Lenti-ORF clone of BTNL2 (Myc-DDK-tagged)-Human butyrophilin-like 2 (MHC class II associated) (BTNL2) 10 ug
$986.00
RC214359L2 Lenti-ORF clone of BTNL2 (mGFP-tagged)-Human butyrophilin-like 2 (MHC class II associated) (BTNL2) 10 ug
$986.00
RC214359L3 Lenti-ORF clone of BTNL2 (Myc-DDK-tagged)-Human butyrophilin-like 2 (MHC class II associated) (BTNL2) 10 ug
$986.00
RC214359L4 Lenti-ORF clone of BTNL2 (mGFP-tagged)-Human butyrophilin-like 2 (MHC class II associated) (BTNL2) 10 ug
$986.00
RG214359 BTNL2 (tGFP-tagged) - Human butyrophilin-like 2 (MHC class II associated) (BTNL2) 10 ug
$886.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products