OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MACROD1 (NM_014067) Human Untagged Clone

Be the first to review this product
SKU
SC304034
MACROD1 (untagged)-Human MACRO domain containing 1 (MACROD1)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA370532 MACROD1 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MACROD1 or NM_014067"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MACROD1
Synonyms LRP16
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_014067 edited
GAGAGACACTCCCGAGCGCCGTAAATAGAGTCCAAGTGGGCGGAGAGCCGTCCCGCGCCG
CCCGCTCATGTCTCTACAGAGCCGACTGTCCGGCCGCCTGGCACAGCTGCGCGCGGCGGG
GCAGCTGCTCGTCCCCCCGCGCCCCCGGCCCGGACACTTGGCGGGTGCCACGAGGACCCG
CAGCAGCACGTGCGGTCCCCCGGCGTTCCTGGGCGTGTTCGGCCGCCGTGCGCGGACCTC
GGCGGGAGTTGGGGCGTGGGGGGCGGCGGCGGTGGGGCGGACAGCCGGGGTGCGCACTTG
GGCCCCCCTGGCCATGGCGGCGAAGGTGGACCTGAGCACCTCCACCGACTGGAAGGAGGC
GAAATCCTTTCTGAAGGGCCTGAGTGACAAGCAGCGGGAGGAACATTACTTCTGCAAGGA
CTTTGTCAGGCTGAAGAAGATCCCGACATGGAAGGAGATGGCGAAAGGGGTGGCTGTGAA
GGTGGAGGAGCCCAGGTATAAAAAGGACAAGCAGCTCAATGAGAAAATCTCCCTGCTCCG
CAGCGACATCACCAAGCTGGAGGTGGACGCCATCGTCAACGCCGCCAACAGCTCCCTGCT
CGGAGGCGGTGGCGTGGACGGCTGCATTCATCGGGCCGCCGGCCCCCTGCTTACCGACGA
GTGCCGGACCCTGCAGAGCTGTAAGACTGGCAAGGCCAAGATCACCGGCGGCTATCGGCT
CCCGGCCAAGTACGTCATCCACACAGTGGGGCCCATCGCCTACGGGGAGCCCAGCGCCAG
CCAGGCTGCCGAGCTCCGCAGCTGCTACCTGAGCAGTCTGGACCTGCTGCTGGAGCACCG
GCTCCGCTCGGTGGCGTTCCCCTGCATCTCCACCGGCGTGTTTGGCTACCCCTGTGAGGC
GGCCGCCGAGATCGTGCTGGCCACGCTGCGAGAGTGGCTGGAGCAGCACAAGGACAAGGT
GGACCGGCTGATCATCTGCGTGTTCCTCGAGAAGGACGAGGACATCTACCGGAGCCGGCT
CCCCCACTACTTCCCCGTGGCCTGAGGCTCCCGCAGCCCACCCTGACCGGGACTGACCCG
CCTTCGGGACCCCGCTCCCAGCTCTGAGAGGTCGCCAAAGCCTGCAGCCTGGCCTGGGCC
TGGCCACCCCTTCTTTCCCTCCGCGCCCCGCCCCCGAGGAGCCTAATAAAGATCTCGTTG
TGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_014067
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014067.2, NP_054786.2
RefSeq Size 1225 bp
RefSeq ORF 978 bp
Locus ID 28992
UniProt ID Q9BQ69
Cytogenetics 11q13.1
Summary Removes ADP-ribose from asparatate and glutamate residues in proteins bearing a single ADP-ribose moiety (PubMed:23474714, PubMed:23474712). Inactive towards proteins bearing poly-ADP-ribose (PubMed:23474714, PubMed:23474712). Deacetylates O-acetyl-ADP ribose, a signaling molecule generated by the deacetylation of acetylated lysine residues in histones and other proteins (PubMed:21257746). Plays a role in estrogen signaling (PubMed:17893710, PubMed:17914104, PubMed:19403568). Binds to androgen receptor (AR) and amplifies the transactivation function of AR in response to androgen (PubMed:19022849). May play an important role in carcinogenesis and/or progression of hormone-dependent cancers by feed-forward mechanism that activates ESR1 transactivation (PubMed:17893710, PubMed:17914104). Could be an ESR1 coactivator, providing a positive feedback regulatory loop for ESR1 signal transduction (PubMed:17914104). Could be involved in invasive growth by down-regulating CDH1 in endometrial cancer cells (PubMed:17893710). Enhances ESR1-mediated transcription activity (PubMed:17914104).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_014067" in other vectors (6)
SKU Description Size Price
RC200992 MACROD1 (Myc-DDK-tagged)-Human MACRO domain containing 1 (MACROD1) 10 ug
$300.00
RC200992L1 Lenti ORF clone of Human MACRO domain containing 1 (MACROD1), Myc-DDK-tagged 10 ug
$600.00
RC200992L2 Lenti ORF clone of Human MACRO domain containing 1 (MACROD1), mGFP tagged 10 ug
$600.00
RC200992L3 Lenti ORF clone of Human MACRO domain containing 1 (MACROD1), Myc-DDK-tagged 10 ug
$600.00
RC200992L4 Lenti ORF clone of Human MACRO domain containing 1 (MACROD1), mGFP tagged 10 ug
$600.00
RG200992 MACROD1 (tGFP-tagged) - Human MACRO domain containing 1 (MACROD1) 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products