OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

COLQ (NM_005677) Human Untagged Clone

Be the first to review this product
SKU
SC303680
COLQ (untagged)-Human collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant I
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA335707 Rabbit Polyclonal Anti-COLQ Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "COLQ or NM_005677"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol COLQ
Synonyms CMS5; EAD
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_005677 edited
TAACTTGACCCTCGCCAGACCCTGGCCAGCATGGTTGTCCTGAATCCAATGACTTTGGGA
ATTTATCTTCAGCTTTTCTTCCTCTCTATCGTGTCTCAGCCGACTTTCATCAACAGCGTT
CTTCCAATCTCAGCAGCCCTTCCCAGCCTGGATCAGAAGAAGCGTGGTGGCCACAAAGCA
TGCTGCCTGCTGACGCCTCCTCCACCACCACTGTTCCCACCACCATTCTTCAGAGGTGGC
CGAAGTCCGCTTCTCTCCCCAGACATGAAGAATCTCATGCTGGAACTGGAGACCTCGCAG
TCCCCGTGCATGCAAGGCTCGCTAGGCTCCCCTGGGCCTCCCGGCCCCCAGGGTCCACCG
GGGCTTCCTGGCAAGACAGGACCAAAGGGAGAAAAGGGGGAGCTTGGCCGACCAGGAAGG
AAGGGTAGACCTGGCCCCCCAGGTGTTCCTGGCATGCCTGGGCCCATCGGTTGGCCAGGC
CCTGAAGGACCCAGGGGTGAAAAAGGTGACCTGGGTATGATGGGCTTGCCAGGGTCAAGA
GGACCAATGGGCTCCAAGGGCTACCCTGGATCCAGAGGGGAAAAGGGATCCAGAGGTGAA
AAGGGTGACCTGGGTCCCAAAGGAGAAAAGGGTTTCCCAGGATTTCCTGGAATGTTGGGG
CAGAAAGGTGAAATGGGTCCAAAAGGTGAACCTGGGATAGCAGGACACCGAGGACCCACA
GGAAGACCAGGAAAACGAGGCAAGCAGGGACAGAAAGGGGATAGTGGAGTTATGGGCCCA
CCAGGCAAGCCTGGGCCTTCTGGTCAACCTGGCCGTCCGGGGCCCCCAGGCCCCCCACCT
GCAGGACAACTTATAATGGGACCCAAAGGGGAAAGAGGATTTCCCGGGCCTCCAGGAAGA
TGTCTTTGTGGACCCACTATGAATGTGAATAACCCTTCCTACGGGGAATCTGTGTATGGG
CCCAGTTCCCCGCGAGTTCCTGTGATTTTTGTGGTCAACAACCAGGAGGAGCTTGAGAGG
CTGAACACCCAAAACGCCATTGCCTTCCGCAGAGACCAGAGATCTCTGTACTTCAAGGAC
AGCCTTGGCTGGCTCCCCATCCAGCTGACCCCTTTCTACCCTGTGGATTACACTGCAGAC
CAGCACGGCACCTGTGGGGATGGGCTCCTGCAGCCTGGGGAGGAGTGTGACGACGGTAAC
AGCGATGTGGGTGACGACTGCATCCGCTGTCACCGTGCCTACTGTGGAGATGGTCACCGG
CATGAGGGTGTGGAGGACTGTGACGGCTCTGACTTTGGCTACCTGACATGCGAGACCTAT
CTCCCTGGGTCATATGGAGACCTGCAATGCACCCAGTACTGCTACATCGACTCCACGCCC
TGCCGCTACTTCACCTGAGGGCCGTGAGGAGAAGGTGGGCTGCGCCCCACAGAACTGGCA
GCAGCTTC
Restriction Sites Please inquire |
ACCN NM_005677
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone is found to be a perfect match to NM_005677.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005677.2, NP_005668.2
RefSeq Size 3011 bp
RefSeq ORF 1368 bp
Locus ID 8292
UniProt ID Q9Y215
Cytogenetics 3p25.1
Protein Families Druggable Genome, Transmembrane
Summary This gene encodes the subunit of a collagen-like molecule associated with acetylcholinesterase in skeletal muscle. Each molecule is composed of three identical subunits. Each subunit contains a proline-rich attachment domain (PRAD) that binds an acetylcholinesterase tetramer to anchor the catalytic subunit of the enzyme to the basal lamina. Mutations in this gene are associated with endplate acetylcholinesterase deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (I) encodes the longest protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_005677" in other vectors (6)
SKU Description Size Price
RC210401 COLQ (Myc-DDK-tagged)-Human collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant I 10 ug
$457.00
RC210401L1 Lenti ORF clone of Human collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant I, Myc-DDK-tagged 10 ug
$757.00
RC210401L2 Lenti ORF clone of Human collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant I, mGFP tagged 10 ug
$757.00
RC210401L3 Lenti ORF clone of Human collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant I, Myc-DDK-tagged 10 ug
$757.00
RC210401L4 Lenti ORF clone of Human collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant I, mGFP tagged 10 ug
$757.00
RG210401 COLQ (tGFP-tagged) - Human collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant I 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products