OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SFTPA1 (NM_005411) Human Untagged Clone

Be the first to review this product
SKU
SC303638
SFTPA1 (untagged)-Human surfactant protein A1 (SFTPA1), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA322605 Anti-SFTPA1 Rabbit Polyclonal Antibody
100 ul
$305.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SFTPA1 or NM_005411"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SFTPA1
Synonyms COLEC4; PSAP; PSP-A; PSPA; SFTP1; SFTPA1B; SP-A; SP-A1; SP-A1 beta; SP-A1 delta; SP-A1 epsilon; SP-A1 gamma; SPA; SPA1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_005411 edited
GCAGCTGGAGGCTCTGTGTGTGGGAGCAGCGACTGGACCCAGAGCCATGTGGCTGTGCCC
TCTGGCCCTCAACCTCATCTTGATGGCAGCCTCTGGTGCTGTGTGCGAAGTGAAGGACGT
TTGTGTTGGAAGCCCTGGTATCCCCGGCACTCCTGGATCCCACGGCCTGCCAGGCAGGGA
CGGGAGAGATGGTCTCAAAGGAGACCCTGGCCCTCCAGGCCCCATGGGTCCACCTGGAGA
AATGCCATGTCCTCCTGGAAATGATGGGCTGCCTGGAGCCCCTGGTATCCCTGGAGAGTG
TGGAGAGAAGGGGGAGCCTGGCGAGAGGGGCCCTCCAGGGCTTCCAGCTCATCTAGATGA
GGAGCTCCAAGCCACACTCCACGACTTTAGACATCAAATCCTGCAGACAAGGGGAGCCCT
CAGTCTGCAGGGCTCCATAATGACAGTAGGAGAGAAGGTCTTCTCCAGCAATGGGCAGTC
CATCACTTTTGATGCCATTCAGGAGGCATGTGCCAGAGCAGGCGGCCGCATTGCTGTCCC
AAGGAATCCAGAGGAAAATGAGGCCATTGCAAGCTTCGTGAAGAAGTACAACACATATGC
CTATGTAGGCCTGACTGAGGGTCCCAGCCCTGGAGACTTCCGCTACTCAGACGGGACCCC
TGTAAACTACACCAACTGGTACCGAGGGGAGCCCGCAGGTCGGGGAAAAGAGCAGTGTGT
GGAGATGTACACAGATGGGCAGTGGAATGACAGGAACTGCCTGTACTCCCGACTGACCAT
CTGTGAGTTCTGAGAGGCATTTAGGCCATGGGACA
Restriction Sites Please inquire |
ACCN NM_005411
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005411.3.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005411.3, NP_005402.3
RefSeq Size 968 bp
RefSeq ORF 747 bp
Locus ID 653509
UniProt ID Q8IWL2
Cytogenetics 10q22.3
Summary This gene encodes a lung surfactant protein that is a member of a subfamily of C-type lectins called collectins. The encoded protein binds specific carbohydrate moieties found on lipids and on the surface of microorganisms. This protein plays an essential role in surfactant homeostasis and in the defense against respiratory pathogens. Mutations in this gene are associated with idiopathic pulmonary fibrosis. Alternate splicing results in multiple transcript variants. provided by RefSeq, May 2010
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 3 and 4 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_005411" in other vectors (6)
SKU Description Size Price
RC220332 SFTPA1 (Myc-DDK-tagged)-Human surfactant protein A1 (SFTPA1), transcript variant 1 10 ug
$300.00
RC220332L1 Lenti ORF clone of Human surfactant protein A1 (SFTPA1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC220332L2 Lenti ORF clone of Human surfactant protein A1 (SFTPA1), transcript variant 1, mGFP tagged 10 ug
$600.00
RC220332L3 Lenti ORF clone of Human surfactant protein A1 (SFTPA1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC220332L4 Lenti ORF clone of Human surfactant protein A1 (SFTPA1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG220332 SFTPA1 (tGFP-tagged) - Human surfactant protein A1 (SFTPA1), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products