OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

NPFFR2 (NM_004885) Human Untagged Clone

Be the first to review this product
SKU
SC303542
NPFFR2 (untagged)-Human neuropeptide FF receptor 2 (NPFFR2), transcript variant 1
  $487.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA340655 Rabbit Polyclonal Anti-NPFFR2 Antibody (C-Terminus)
50 ug
$550.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "NPFFR2 or NM_004885"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NPFFR2
Synonyms GPR74; HLWAR77; NPFF2; NPGPR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004885 edited
ATGAATGAGAAATGGGACACAAACTCTTCAGAAAACTGGCATCCCATCTGGAATGTCAAT
GACACAAAGCATCATCTGTACTCAGATATTAATATTACCTATGTGAACTACTATCTTCAC
CAGCCTCAAGTGGCAGCAATCTTCATTATTTCCTACTTTCTGATCTTCTTTTTGTGCATG
ATGGGAAATACTGTGGTTTGCTTTATTGTAATGAGGAACAAACATATGCACACAGTCACT
AATCTCTTCATCTTAAACCTGGCCATAAGTGATTTACTAGTTGGCATATTCTGCATGCCT
ATAACACTGCTGGACAATATTATAGCAGGATGGCCATTTGGAAACACGATGTGCAAGATC
AGTGGATTGGTCCAGGGAATATCTGTCGCAGCTTCAGTCTTTACGTTAGTTGCAATTGCT
GTAGATAGGTTCCAGTGTGTGGTCTACCCTTTTAAACCAAAGCTCACTATCAAGACAGCG
TTTGTCATTATTATGATCATCTGGGTCCTAGCCATCACCATTATGTCTCCATCTGCAGTA
ATGTTACATGTGCAAGAAGAAAAATATTACCGAGTGAGACTCAACTCCCAGAATAAAACC
AGTCCAGTCTACTGGTGCCGGGAAGACTGGCCAAATCAGGAAATGAGGAAGATCTACACC
ACTGTGCTGTTTGCCAACATCTACCTGGCTCCCCTCTCCCTCATTGTCATCATGTATGGA
AGGATTGGAATTTCACTCTTCAGGGCTGCAGTTCCTCACACAGGCAGGAAGAACCAGGAG
CAGTGGCACGTGGTGTCCAGGAAGAAGCAGAAGATCATTAAGATGCTCCTGATTGTGGCC
CTGCTTTTTATTCTCTCATGGCTGCCCCTGTGGACTCTAATGATGCTCTCAGACTACGCT
GACCTTTCTCCAAATGAACTGCAGATCATCAACATCTACATCTACCCTTTTGCACACTGG
CTGGCATTCGGCAACAGCAGTGTCAATCCCATCATTTATGGTTTCTTCAACGAGAATTTC
CGCCGTGGTTTCCAAGAAGCTTTCCAGCTCCAGCTCTGCCAAAAAAGAGCAAAGCCTATG
GAAGCTTATGCCCTAAAAGCTAAAAGCCATGTGCTCATAAACACATCTAATCAGCTTGTC
CAGGAATCTACATTTCAAAACCCTCATGGGGAAACCTTGCTTTATAGGAAAAGTGCTGAA
AAACCCCAACAGGAATTAGTGATGGAAGAATTAAAAGAAACTACTAACAGCAGTGAGATT
Restriction Sites Please inquire |
ACCN NM_004885
Insert Size 1600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation TrueClone.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004885.3
RefSeq Size 1936 bp
RefSeq ORF 1569 bp
Locus ID 10886
UniProt ID Q9Y5X5
Cytogenetics 4q13.3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Summary This gene encodes a member of a subfamily of G-protein-coupled neuropeptide receptors. This protein is activated by the neuropeptides A-18-amide (NPAF) and F-8-amide (NPFF) and may function in pain modulation and regulation of the opioid system. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jan 2009
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_004885" in other vectors (4)
SKU Description Size Price
RC218229 NPFFR2 (Myc-DDK-tagged)-Human neuropeptide FF receptor 2 (NPFFR2), transcript variant 1 10 ug
$289.00 $486.00
RC218229L3 Lenti ORF clone of Human neuropeptide FF receptor 2 (NPFFR2), transcript variant 1, Myc-DDK-tagged 10 ug
$786.00
RC218229L4 Lenti ORF clone of Human neuropeptide FF receptor 2 (NPFFR2), transcript variant 1, mGFP tagged 10 ug
$786.00
RG218229 NPFFR2 (tGFP-tagged) - Human neuropeptide FF receptor 2 (NPFFR2), transcript variant 1 10 ug
$489.00 $686.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products