OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

KCNS1 (NM_002251) Human Untagged Clone

Be the first to review this product
SKU
SC303156
KCNS1 (untagged)-Human potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1 (KCNS1)
  $491.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA338531 Rabbit Polyclonal Anti-KCNS1 Antibody
100 ul
$575.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "KCNS1 or NM_002251"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KCNS1
Synonyms Kv9.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303156 representing NM_002251.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGATGCTGCTGGTCCGGGGAACACACTATGAGAACCTCCGGTCTAAAGTGGTGCTGCCAACACCC
CTAGGAGGGAGGAGCACTGAAACCTTTGTGAGCGAGTTCCCGGGCCCCGACACCGGGATCCGCTGGCGG
CGAAGCGACGAGGCGCTGCGCGTGAACGTGGGTGGCGTGCGGCGGCAGCTGAGCGCGCGCGCCCTGGCG
CGCTTCCCGGGCACGCGGCTGGGCCGCCTGCAGGCCGCGGCGTCGGAGGAGCAGGCGCGGCGCCTGTGC
GACGACTACGACGAGGCGGCGCGCGAATTCTACTTCGACCGGCACCCGGGCTTCTTCCTGAGCCTGCTG
CACTTCTACCGCACTGGCCACCTGCACGTGCTCGACGAGCTGTGCGTCTTCGCCTTTGGCCAGGAGGCC
GACTACTGGGGCCTAGGCGAGAACGCGCTTGCCGCGTGCTGCCGCGCGCGCTACCTGGAGAGGCGGCTG
ACCCAGCCGCACGCCTGGGACGAGGACAGCGACACGCCGAGCAGCGTGGACCCGTGCCCCGACGAGATC
TCCGACGTGCAGCGAGAACTGGCGCGCTATGGCGCGGCGCGCTGTGGCCGCCTGCGCCGCCGCCTCTGG
CTGACCATGGAGAACCCGGGCTACTCGCTGCCGAGCAAGCTCTTCAGCTGCGTCTCCATCAGCGTGGTG
CTCGCCTCCATCGCCGCCATGTGCATCCACAGCCTGCCCGAGTACCAGGCCCGCGAGGCGGCGGCCGCC
GTGGCTGCGGTGGCCGCGGGCCGCAGCCCGGAAGGCGTGCGCGACGACCCGGTGCTGCGACGCCTCGAG
TACTTCTGCATCGCCTGGTTCAGCTTCGAGGTGTCGTCGCGCCTCCTGCTGGCGCCCAGTACGCGCAAC
TTCTTCTGCCACCCGCTCAACCTCATCGACATTGTGTCTGTGCTGCCCTTCTATCTCACGCTGCTGGCT
GGTGTGGCACTGGGCGACCAGGGCGGCAAGGAGTTCGGCCACCTGGGCAAGGTGGTGCAGGTGTTCCGC
CTCATGCGCATCTTCCGCGTACTCAAGTTGGCGCGCCATTCCACCGGGCTGCGCTCGCTGGGAGCCACG
CTCAAGCACAGCTACCGTGAGGTGGGCATCTTGCTGCTGTACCTGGCTGTGGGTGTGTCAGTGTTCTCT
GGTGTGGCCTACACAGCTGAAAAGGAGGAGGACGTGGGCTTTAACACCATCCCAGCCTGCTGGTGGTGG
GGCACAGTGAGCATGACCACCGTGGGCTATGGGGATGTGGTGCCAGTGACGGTGGCTGGCAAGCTGGCA
GCCTCAGGCTGCATCCTAGGGGGCATCCTGGTGGTAGCACTCCCCATCACCATCATCTTCAACAAGTTC
TCCCACTTCTACCGGCGCCAGAAGGCTCTGGAGGCAGCCGTGCGCAACAGCAACCACCAAGAGTTTGAG
GACTTGCTGAGCAGCATTGATGGGGTGTCGGAGGCATCTCTGGAGACATCCCGAGAAACCTCTCAGGAG
GGACAGTCTGCAGATCTAGAGAGCCAGGCCCCCAGTGAGCCTCCACACCCTCAGATGTATTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_002251
Insert Size 1581 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002251.4
RefSeq Size 5648 bp
RefSeq ORF 1581 bp
Locus ID 3787
UniProt ID Q96KK3
Cytogenetics 20q13.12
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
MW 58.4 kDa
Summary Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002251" in other vectors (4)
SKU Description Size Price
RC220023 KCNS1 (Myc-DDK-tagged)-Human potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1 (KCNS1) 10 ug
$734.00
RC220023L3 Lenti ORF clone of Human potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1 (KCNS1), Myc-DDK-tagged 10 ug
$1,034.00
RC220023L4 Lenti ORF clone of Human potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1 (KCNS1), mGFP tagged 10 ug
$1,034.00
RG220023 KCNS1 (tGFP-tagged) - Human potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1 (KCNS1) 10 ug
$934.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products