AGRP (NM_001138) Human Untagged Clone

SKU
SC302977
AGRP (untagged)-Human agouti related protein homolog (mouse) (AGRP)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol AGRP
Synonyms AGRT; ART; ASIP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302977 representing NM_001138.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGACCGCAGCGGTGCTGAGCTGTGCCCTGCTGCTGGCACTGCCTGCCACGCGAGGAGCCCAGATG
GGCTTGGCCCCCATGGAGGGCATCAGAAGGCCTGACCAGGCCCTGCTCCCAGAGCTCCCAGGCCTGGGC
CTGCGGGCCCCACTGAAGAAGACAACTGCAGAACAGGCAGAAGAGGATCTGTTGCAGGAGGCTCAGGCC
TTGGCAGAGGTACTAGACCTGCAGGACCGCGAGCCCCGCTCCTCACGTCGCTGCGTAAGGCTGCATGAG
TCCTGCCTGGGACAGCAGGTGCCTTGCTGTGACCCATGTGCCACGTGCTACTGCCGCTTCTTCAATGCC
TTCTGCTACTGCCGCAAGCTGGGTACTGCCATGAATCCCTGCAGCCGCACCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001138
Insert Size 399 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001138.1
RefSeq Size 783 bp
RefSeq ORF 399 bp
Locus ID 181
UniProt ID O00253
Cytogenetics 16q22.1
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Adipocytokine signaling pathway
MW 14.4 kDa
Summary This gene encodes an antagonist of the melanocortin-3 and melanocortin-4 receptor. It appears to regulate hypothalamic control of feeding behavior via melanocortin receptor and/or intracellular calcium regulation, and thus plays a role in weight homeostasis. Mutations in this gene have been associated with late on-set obesity. [provided by RefSeq, Dec 2009]
Transcript Variant: Transcript variant 1 contains a noncoding 5' exon and is expressed only in brain.
Write Your Own Review
You're reviewing:AGRP (NM_001138) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217144 AGRP (Myc-DDK-tagged)-Human agouti related protein homolog (mouse) (AGRP) 10 ug
$150.00
RC217144L1 Lenti ORF clone of Human agouti related protein homolog (mouse) (AGRP), Myc-DDK-tagged 10 ug
$450.00
RC217144L2 Lenti ORF clone of Human agouti related protein homolog (mouse) (AGRP), mGFP tagged 10 ug
$450.00
RC217144L3 Lenti ORF clone of Human agouti related protein homolog (mouse) (AGRP), Myc-DDK-tagged 10 ug
$450.00
RC217144L4 Lenti ORF clone of Human agouti related protein homolog (mouse) (AGRP), mGFP tagged 10 ug
$450.00
RG217144 AGRP (tGFP-tagged) - Human agouti related protein homolog (mouse) (AGRP) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.