OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PPM1B (NM_001033556) Human Untagged Clone

Be the first to review this product
SKU
SC302726
PPM1B (untagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 4
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA502866 PPM1B mouse monoclonal antibody, clone OTI3C9 (formerly 3C9) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PPM1B or NM_001033556"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PPM1B
Synonyms PP2C-beta-X; PP2CB; PP2CBETA; PPC2BETAX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302726 representing NM_001033556.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTGCATTTTTGGATAAACCCAAAACTGAAAAACATAATGCTCATGGTGCTGGGAATGGTTTACGT
TATGGCCTGAGCAGCATGCAAGGATGGAGAGTGGAAATGGAAGATGCACACACAGCTGTTGTAGGTATT
CCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATGATGGTCATGCTGGATCCCGAGTGGCAAAT
TACTGCTCAACACATTTATTAGAACACATCACTACTAACGAAGACTTTAGGGCAGCTGGAAAATCAGGA
TCTGCTCTTGAGCTTTCAGTGGAAAATGTTAAGAATGGTATCAGAACTGGATTTTTGAAAATTGATGAA
TACATGCGTAACTTTTCAGACCTCAGAAACGGGATGGACAGGAGTGGTTCAACTGCAGTGGGAGTTATG
ATTTCACCTAAGCATATCTACTTTATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATGGACAA
GTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAAAAGGAGCGAATCCAAAATGCAGGA
GGCAGCGTGATGATACAACGTGTTAATGGTTCATTAGCAGTATCTCGTGCTCTGGGGGACTATGATTAC
AAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTGTTTCTCCAGAGCCTGAGGTTTATGAAATTTTA
AGAGCAGAAGAGGATGAATTTATCATCTTGGCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAG
CTCTGTGAATATGTTAAATCTAGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTG
GACACTTGTTTACACAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGCTCCC
AAGGTCTCAGATGAAGCGGTGAAAAAAGATTCAGAGTTGGATAAGCACTTGGAATCACGGGTTGAAGGT
AAGACAAATGCTTTTTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001033556
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001033556.1
RefSeq Size 1497 bp
RefSeq ORF 984 bp
Locus ID 5495
Cytogenetics 2p21
Protein Families Druggable Genome, Phosphatase, Stem cell - Pluripotency
Protein Pathways MAPK signaling pathway
MW 36.3 kDa
Summary The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to cause cell-growth arrest or cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional transcript variants have been described, but currently do not represent full-length sequences. provided by RefSeq, Jul 2008
Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The resulting protein (isoform 4) has a distinct and shorter C-terminus, compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001033556" in other vectors (4)
SKU Description Size Price
RC213787 PPM1B (Myc-DDK-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 4 10 ug
$300.00
RC213787L3 Lenti-ORF clone of PPM1B (Myc-DDK-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 4 10 ug
$600.00
RC213787L4 Lenti-ORF clone of PPM1B (mGFP-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 4 10 ug
$600.00
RG213787 PPM1B (tGFP-tagged) - Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 4 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products