OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RAB24 (NM_001031677) Human Untagged Clone

Be the first to review this product
SKU
SC302525
RAB24 (untagged)-Human RAB24, member RAS oncogene family (RAB24), transcript variant 1
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA505690 RAB24 mouse monoclonal antibody, clone OTI3H1 (formerly 3H1) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RAB24 or NM_001031677"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RAB24
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302525 representing NM_001031677.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCGGGCAGCGCGTGGACGTCAAGGTGGTGATGCTGGGCAAGGAGTACGTGGGCAAGACTAGCCTG
GTGGAGCGCTACGTGCACGACCGCTTTCTGGTGGGGCCTTATCAGAACACCATCGGGGCCGCCTTCGTG
GCCAAGGTGATGTCGGTCGGAGACCGGACTGTGACATTAGGTATTTGGGACACAGCAGGCTCTGAGCGC
TATGAGGCCATGAGTAGAATCTACTATCGGGGTGCCAAGGCTGCCATCGTCTGCTATGACCTCACAGAC
AGCAGCAGCTTTGAGCGAGCAAAGTTCTGGGTGAAGGAACTGCGCAGCCTAGAGGAGGGCTGCCAAATC
TACTTATGTGGCACCAAGAGTGACCTGCTGGAAGAAGACCGGAGGCGTCGACGTGTGGACTTCCACGAC
GTCCAGGACTATGCAGACAATATCAAAGCTCAGCTCTTTGAAACATCCAGCAAGACAGGCCAGAGTGTG
GACGAGCTCTTCCAGAAAGTGGCAGAGGATTACGTCAGTGTGGCTGCCTTCCAGGTGATGACAGAGGAC
AAGGGCGTGGATCTGGGCCAGAAGCCAAACCCCTACTTCTACAGCTGTTGTCATCACTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001031677
Insert Size 612 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001031677.3
RefSeq Size 1632 bp
RefSeq ORF 612 bp
Locus ID 53917
UniProt ID Q969Q5
Cytogenetics 5q35.3
Protein Families Druggable Genome
MW 23.1 kDa
Summary RAB24 is a small GTPase of the Rab subfamily of Ras-related proteins that regulate intracellular protein trafficking (Olkkonen et al., 1993 PubMed 8126105).supplied by OMIM, Aug 2009
Transcript Variant: This variant (1) encodes the functional protein. Both variants 1 and 2 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001031677" in other vectors (5)
SKU Description Size Price
RC205647 RAB24 (Myc-DDK-tagged)-Human RAB24, member RAS oncogene family (RAB24), transcript variant 1 10 ug
$300.00
RC205647L3 Lenti ORF clone of Human RAB24, member RAS oncogene family (RAB24), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC205647L4 Lenti ORF clone of Human RAB24, member RAS oncogene family (RAB24), transcript variant 1, mGFP tagged 10 ug
$600.00
RG205647 RAB24 (tGFP-tagged) - Human RAB24, member RAS oncogene family (RAB24), transcript variant 1 10 ug
$489.00 $500.00
SC320426 RAB24 (untagged)-Human RAB24, member RAS oncogene family (RAB24), transcript variant 1 10 ug
$300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products