OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

HCST (NM_001007469) Human Untagged Clone

Be the first to review this product
SKU
SC301216
HCST (untagged)-Human hematopoietic cell signal transducer (HCST), transcript variant 2
  $165.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "HCST or NM_001007469"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HCST
Synonyms DAP10; KAP10; PIK3AP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC301216 representing NM_001007469.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATCCATCTGGGTCACATCCTCTTCCTGCTTTTGCTCCCAGTGGCTGCAGCTCAGACGACTCCAGGA
GAGAGATCATCACTCCCTGCCTTTTACCCTGGCACTTCAGGCTCTTGTTCCGGATGTGGGTCCCTCTCT
CTGCCGCTCCTGGCAGGCCTCGTGGCTGCTGATGCGGTGGCATCGCTGCTCATCGTGGGGGCGGTGTTC
CTGTGCGCACGCCCACGCCGCAGCCCCGCCCAAGATGGCAAAGTCTACATCAACATGCCAGGCAGGGGC
TGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001007469
Insert Size 279 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001007469.1
RefSeq Size 521 bp
RefSeq ORF 279 bp
Locus ID 10870
UniProt ID Q9UBK5
Cytogenetics 19q13.12
Protein Families Druggable Genome, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity
MW 9.4 kDa
Summary This gene encodes a transmembrane signaling adaptor that contains a YxxM motif in its cytoplasmic domain. The encoded protein may form part of the immune recognition receptor complex with the C-type lectin-like receptor NKG2D. As part of this receptor complex, this protein may activate phosphatidylinositol 3-kinase dependent signaling pathways through its intracytoplasmic YxxM motif. This receptor complex may have a role in cell survival and proliferation by activation of NK and T cell responses. Alternative splicing results in two transcript variants encoding different isoforms. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001007469" in other vectors (4)
SKU Description Size Price
RC219253 HCST (Myc-DDK-tagged)-Human hematopoietic cell signal transducer (HCST), transcript variant 2 10 ug
$150.00
RC219253L3 Lenti ORF clone of Human hematopoietic cell signal transducer (HCST), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC219253L4 Lenti ORF clone of Human hematopoietic cell signal transducer (HCST), transcript variant 2, mGFP tagged 10 ug
$450.00
RG219253 HCST (tGFP-tagged) - Human hematopoietic cell signal transducer (HCST), transcript variant 2 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products