OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SMAD1 (NM_001003688) Human Untagged Clone

Be the first to review this product
SKU
SC300516
SMAD1 (untagged)-Human SMAD family member 1 (SMAD1), transcript variant 2
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA507245 SMAD1 mouse monoclonal antibody, clone OTI1E2 (formerly 1E2) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SMAD1 or NM_001003688"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SMAD1
Synonyms BSP-1; BSP1; JV4-1; JV41; MADH1; MADR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300516 representing NM_001003688.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAATGTGACAAGTTTATTTTCCTTTACAAGTCCAGCTGTGAAGAGACTTCTTGGGTGGAAACAGGGC
GATGAAGAAGAAAAATGGGCAGAGAAAGCTGTTGATGCTTTGGTGAAAAAACTGAAGAAAAAGAAAGGT
GCCATGGAGGAACTGGAAAAGGCCTTGAGCTGCCCAGGGCAACCGAGTAACTGTGTCACCATTCCCCGC
TCTCTGGATGGCAGGCTGCAAGTCTCCCACCGGAAGGGACTGCCTCATGTCATTTACTGCCGTGTGTGG
CGCTGGCCCGATCTTCAGAGCCACCATGAACTAAAACCACTGGAATGCTGTGAGTTTCCTTTTGGTTCC
AAGCAGAAGGAGGTCTGCATCAATCCCTACCACTATAAGAGAGTAGAAAGCCCTGTACTTCCTCCTGTG
CTGGTTCCAAGACACAGCGAATATAATCCTCAGCACAGCCTCTTAGCTCAGTTCCGTAACTTAGGACAA
AATGAGCCTCACATGCCACTCAACGCCACTTTTCCAGATTCTTTCCAGCAACCCAACAGCCACCCGTTT
CCTCACTCTCCCAATAGCAGTTACCCAAACTCTCCTGGGAGCAGCAGCAGCACCTACCCTCACTCTCCC
ACCAGCTCAGACCCAGGAAGCCCTTTCCAGATGCCAGCTGATACGCCCCCACCTGCTTACCTGCCTCCT
GAAGACCCCATGACCCAGGATGGCTCTCAGCCGATGGACACAAACATGATGGCGCCTCCCCTGCCCTCA
GAAATCAACAGAGGAGATGTTCAGGCGGTTGCTTATGAGGAACCAAAACACTGGTGCTCTATTGTCTAC
TATGAGCTCAACAATCGTGTGGGTGAAGCGTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGTTTC
ACTGATCCTTCCAACAATAAGAACCGTTTCTGCCTTGGGCTGCTCTCCAATGTTAACCGGAATTCCACT
ATTGAAAACACCAGGCGGCATATTGGAAAAGGAGTTCATCTTTATTATGTTGGAGGGGAGGTGTATGCC
GAATGCCTTAGTGACAGTAGCATCTTTGTGCAAAGTCGGAACTGCAACTACCATCATGGATTTCATCCT
ACTACTGTTTGCAAGATCCCTAGTGGGTGTAGTCTGAAAATTTTTAACAACCAAGAATTTGCTCAGTTA
TTGGCACAGTCTGTGAACCATGGATTTGAGACAGTCTATGAGCTTACAAAAATGTGTACTATACGTATG
AGCTTTGTGAAGGGCTGGGGAGCAGAATACCACCGCCAGGATGTTACTAGCACCCCCTGCTGGATTGAG
ATACATCTGCACGGCCCCCTCCAGTGGCTGGATAAAGTTCTTACTCAAATGGGTTCACCTCATAATCCT
ATTTCATCTGTATCTTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001003688
Insert Size 1398 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001003688.1
RefSeq Size 2880 bp
RefSeq ORF 1398 bp
Locus ID 4086
UniProt ID Q15797
Cytogenetics 4q31.21
Protein Families Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Stem cell relevant signaling - JAK/STAT signaling pathway, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors
Protein Pathways TGF-beta signaling pathway
MW 52.3 kDa
Summary The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 3. All eight variants encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001003688" in other vectors (6)
SKU Description Size Price
RC200299 SMAD1 (Myc-DDK-tagged)-Human SMAD family member 1 (SMAD1), transcript variant 2 10 ug
$457.00
RC200299L1 Lenti ORF clone of Human SMAD family member 1 (SMAD1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC200299L2 Lenti ORF clone of Human SMAD family member 1 (SMAD1), transcript variant 2, mGFP tagged 10 ug
$757.00
RC200299L3 Lenti ORF clone of Human SMAD family member 1 (SMAD1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC200299L4 Lenti ORF clone of Human SMAD family member 1 (SMAD1), transcript variant 2, mGFP tagged 10 ug
$757.00
RG200299 SMAD1 (tGFP-tagged) - Human SMAD family member 1 (SMAD1), transcript variant 2 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products