OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Glucosidase 2 subunit beta (PRKCSH) (NM_001001329) Human Untagged Clone

Be the first to review this product
SKU
SC300164
PRKCSH (untagged)-Human protein kinase C substrate 80K-H (PRKCSH), transcript variant 2
  $539.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA366548 PRKCSH rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Glucosidase 2 subunit beta or NM_001001329"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Glucosidase 2 subunit beta
Synonyms AGE-R2; G19P1; GIIB; PCLD; PCLD1; PKCSH; PLD1; VASAP-60
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001001329, the custom clone sequence may differ by one or more nucleotides
ATGCTGTTGCCGCTGCTGCTGCTGCTACCCATGTGCTGGGCCGTGGAGGTCAAGAGGCCC
CGGGGCGTCTCCCTCACCAATCATCACTTCTACGATGAGTCCAAGCCTTTCACCTGCCTG
GACGGTTCGGCCACCATCCCATTTGATCAGGTCAACGATGACTATTGCGACTGCAAAGAT
GGCTCTGACGAGCCAGGCACGGCTGCCTGTCCTAATGGCAGCTTCCACTGCACCAACACT
GGCTATAAGCCCCTGTATATCCCCTCCAACCGGGTCAACGATGGTGTTTGTGACTGCTGC
GATGGAACAGACGAGTACAACAGCGGCGTCATCTGTGAGAACACCTGCAAAGAGAAGGGC
CGTAAGGAGAGAGAGTCCCTGCAGCAGATGGCCGAGGTCACCCGCGAAGGGTTCCGTCTG
AAGAAGATCCTTATTGAGGACTGGAAGAAGGCACGGGAGGAGAAGCAGAAAAAGCTCATT
GAGCTACAGGCTGGGAAGAAGTCTCTGGAAGACCAGGTGGAGATGCTGCGGACAGTGAAG
GAGGAAGCTGAGAAGCCAGAGAGAGAGGCCAAAGAGCAGCACCAGAAGCTGTGGGAAGAG
CAGCTGGCTGCTGCCAAGGCCCAACAGGAGCAGGAGCTGGCGGCTGATGCCTTCAAGGAG
CTGGATGATGACATGGACGGGACGGTCTCGGTGACTGAGCTGCAGACTCACCCGGAGCTG
GACACAGATGGGGATGGGGCGTTGTCAGAAGCGGAAGCTCAGGCCCTCCTCAGTGGGGAC
ACACAGACAGACGCCACCTCTTTCTACGACCGCGTCTGGGCCGCCATCAGGGACAAGTAC
CGGTCCGAGGCACTGCCCACCGACCTTCCAGCACCTTCTGCCCCTGACTTGACGGAGCCC
AAGGAGGAGCAGCCGCCAGTGCCCTCGTCGCCCACAGAGGAGGAGGAGGAGGAGGAGGAG
GAGGAGGAAGAAGAGGCTGAAGAAGAGGAGGAGGAGGAGGATTCCGAGGTGCAGGGGGAG
CAGCCCAAGCCGGCCAGCCCTGCTGAGGAAGACAAAATGCCGCCCTACGACGAGCAGACG
CAGGCCTTCATCGATGCTGCCCAGGAGGCCCGCAACAAGTTCGAGGAGGCCGAGCGGTCG
CTGAAGGACATGGAGGAGTCCATCAGGAACCTGGAGCAAGAGATTTCTTTTGACTTTGGC
CCCAACGGGGAGTTTGCTTACCTGTACAGCCAGTGCTACGAGCTCACCACCAACGAATAC
GTCTACCGCCTCTGCCCCTTCAAGCTTGTCTCGCAGAAACCCAAACTCGGGGGCTCTCCC
ACCAGCCTTGGCACCTGGGGCTCATGGATTGGCCCCGACCACGACAAGTTCAGTGCCATG
AAGTATGAGCAAGGCACGGGCTGCTGGCAGGGCCCCAACCGCTCCACCACCGTGCGCCTC
CTGTGCGGGAAAGAGACCATGGTGACCAGCACCACAGAGCCCAGTCGCTGCGAGTACCTC
ATGGAGCTGATGACGCCAGCCGCCTGCCCGGAGCCACCGCCTGAAGCACCCACCGAAGAC
GACCATGACGAGCTCTAG
Restriction Sites Please inquire |
ACCN NM_001001329
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001001329.1, NP_001001329.1
RefSeq Size 2253 bp
RefSeq ORF 1578 bp
Locus ID 5589
UniProt ID P14314
Cytogenetics 19p13.2
Protein Families Druggable Genome
Summary This gene encodes the beta-subunit of glucosidase II, an N-linked glycan-processing enzyme in the endoplasmic reticulum. The encoded protein is an acidic phosphoprotein known to be a substrate for protein kinase C. Mutations in this gene have been associated with the autosomal dominant polycystic liver disease. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jan 2014
Transcript Variant: This variant (2) has a longer 5' UTR, and uses two alternate in-frame splice sites in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Both variants 2 and 3 encode the same isoform.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001001329" in other vectors (4)
SKU Description Size Price
RC213328 PRKCSH (Myc-DDK-tagged)-Human protein kinase C substrate 80K-H (PRKCSH), transcript variant 2 10 ug
$289.00 $489.00
RC213328L3 Lenti-ORF clone of PRKCSH (Myc-DDK-tagged)-Human protein kinase C substrate 80K-H (PRKCSH), transcript variant 2 10 ug
$789.00
RC213328L4 Lenti-ORF clone of PRKCSH (mGFP-tagged)-Human protein kinase C substrate 80K-H (PRKCSH), transcript variant 2 10 ug
$789.00
RG213328 PRKCSH (tGFP-tagged) - Human protein kinase C substrate 80K-H (PRKCSH), transcript variant 2 10 ug
$689.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products