OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Rhodopsin (RHO) (NM_000539) Human Untagged Clone

Be the first to review this product
SKU
SC300090
RHO (untagged)-Human rhodopsin (RHO)
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA309469 Mouse Monoclonal anti-RHO Antibody
100 ug
$745.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Rhodopsin or NM_000539"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Rhodopsin
Synonyms CSNBAD1; OPN2; RP4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000539 edited
CCAGCTGGAGCCCTGAGTGGCTGAGCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGC
CACGGGTCAGCCACAAGGGCCACAGCCATGAATGGCACAGAAGGCCCTAACTTCTACGTG
CCCTTCTCCAATGCGACGGGTGTGGTACGCAGCCCCTTCGAGTACCCACAGTACTACCTG
GCTGAGCCATGGCAGTTCTCCATGCTGGCCGCCTACATGTTTCTGCTGATCGTGCTGGGC
TTCCCCATCAACTTCCTCACGCTCTACGTCACCGTCCAGCACAAGAAGCTGCGCACGCCT
CTCAACTACATCCTGCTCAACCTAGCCGTGGCTGACCTCTTCATGGTCCTAGGTGGCTTC
ACCAGCACCCTCTACACCTCTCTGCATGGATACTTCGTCTTCGGGCCCACAGGATGCAAT
TTGGAGGGCTTCTTTGCCACCCTGGGCGGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTG
GCCATCGAGCGGTACGTGGTGGTGTGTAAGCCCATGAGCAACTTCCGCTTCGGGGAGAAC
CATGCCATCATGGGCGTTGCCTTCACCTGGGTCATGGCGCTGGCCTGCGCCGCACCCCCA
CTCGCCGGCTGGTCCAGGTACATCCCCGAGGGCCTGCAGTGCTCGTGTGGAATCGACTAC
TACACGCTCAAGCCGGAGGTCAACAACGAGTCTTTTGTCATCTACATGTTCGTGGTCCAC
TTCACCATCCCCATGATTATCATCTTTTTCTGCTATGGGCAGCTCGTCTTCACCGTCAAG
GAGGCCGCTGCCCAGCAGCAGGAGTCAGCCACCACACAGAAGGCAGAGAAGGAGGTCACC
CGCATGGTCATCATCATGGTCATCGCTTTCCTGATCTGCTGGGTGCCCTACGCCAGCGTG
GCATTCTACATCTTCACCCACCAGGGCTCCAACTTCGGTCCCATCTTCATGACCATCCCA
GCGTTCTTTGCCAAGAGCGCCGCCATCTACAACCCTGTCATCTATATCATGATGAACAAG
CAGTTCCGGAACTGCATGCTCACCACCATCTGCTGCGGCAAGAACCCACTGGGTGACGAT
GAGGCCTCTGCTACCGTGTCCAAGACGGAGACGAGCCAGGTGGCCCCGGCCTAAGACCTG
CCTAGGACTCTGTGGCCGACTATAGGCGTCTCCCATCCCCTACACCTTCCCCCAGCCACA
GCCATCCCACCAG
Restriction Sites Please inquire |
ACCN NM_000539
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000539.2, NP_000530.1
RefSeq Size 2767 bp
RefSeq ORF 1047 bp
Locus ID 6010
UniProt ID P08100
Cytogenetics 3q22.1
Protein Families Druggable Genome, Transmembrane
Summary The protein encoded by this gene is found in rod cells in the back of the eye and is essential for vision in low-light conditions. The encoded protein binds to 11-cis retinal and is activated when light hits the retinal molecule. Defects in this gene are a cause of congenital stationary night blindness. provided by RefSeq, Aug 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_000539" in other vectors (6)
SKU Description Size Price
RC211328 RHO (Myc-DDK-tagged)-Human rhodopsin (RHO) 10 ug
$457.00
RC211328L1 Lenti ORF clone of Human rhodopsin (RHO), Myc-DDK-tagged 10 ug
$757.00
RC211328L2 Lenti ORF clone of Human rhodopsin (RHO), mGFP tagged 10 ug
$757.00
RC211328L3 Lenti ORF clone of Human rhodopsin (RHO), Myc-DDK-tagged 10 ug
$757.00
RC211328L4 Lenti ORF clone of Human rhodopsin (RHO), mGFP tagged 10 ug
$757.00
RG211328 RHO (tGFP-tagged) - Human rhodopsin (RHO) 10 ug
$489.00 $657.00

file-alt Citations

Assessing the correlation between mutant rhodopsin stability and the severity of retinitis pigmentosa
McKeone, Wikstrom, Kiel et al
Mol. Vis. (2014) 20, 183-99
AI Summary: OriGene contributed to this study by providing the Rhodopsin ORF plasmid (RC211328), which was sub-cloned into a GFP-tagged vector to create the custom RHO-AC-mGFP plasmid used for mutagenesis and expression analysis in HEK-293 cells.
Snippet: The Rhodopsin ORF was sub-cloned by Origene from plasmid RC211328 into the vector pCMV6-AC-mGFP to produce the custom-built vector RHO-AC-mGFP (Figure 1). Figure 1 Figure 1. Map of the RHO-AC-mGFP plasmid. ... Cite SaveSaving
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products