OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

HSD17B3 (NM_000197) Human Untagged Clone

Be the first to review this product
SKU
SC300022
HSD17B3 (untagged)-Human hydroxysteroid (17-beta) dehydrogenase 3 (HSD17B3)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA811500 HSD17B3 mouse monoclonal antibody,clone OTI7F7 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "HSD17B3 or NM_000197"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HSD17B3
Synonyms EDH17B3; SDR12C2
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000197 edited
GCCAGGGCTGAAACAGTCTGTTGAGTGCAGCCATGGGGGACGTCCTGGAACAGTTCTTCA
TCCTCACAGGGCTGCTGGTGTGCCTGGCCTGCCTGGCGAAGTGCGTGAGATTCTCCAGAT
GTGTTTTACTGAACTACTGGAAAGTTTTGCCAAAGTCTTTCTTGCGGTCAATGGGACAGT
GGGCAGTGATCACTGGAGCAGGCGATGGAATTGGGAAAGCGTACTCGTTCGAGCTAGCAA
AACGTGGACTCAATGTTGTCCTTATTAGCCGGACGCTGGAAAAACTAGAGGCCATTGCCA
CAGAGATCGAGCGGACTACAGGGAGGAGTGTGAAGATTATACAAGCAGATTTTACAAAAG
ATGACATCTACGAGCATATTAAAGAAAAACTTGCAGGCTTAGAAATTGGAATTTTAGTCA
ACAATGTCGGAATGCTTCCAAACCTTCTCCCAAGCCATTTCCTGAACGCACCGGATGAAA
TCCAGAGCCTCATCCATTGTAACATCACCTCCGTAGTCAAGATGACACAGCTAATTCTGA
AACATATGGAATCAAGGCAGAAAGGTCTCATCCTGAACATTTCTTCTGGGATAGCCCTGT
TTCCTTGGCCTCTCTACTCCATGTACTCAGCTTCCAAGGCGTTTGTGTGCGCATTTTCCA
AGGCCCTGCAAGAGGAATATAAAGCAAAAGAAGTCATCATCCAGGTGCTGACCCCATATG
CTGTCTCGACTGCAATGACAAAGTATCTAAATACAAATGTGATAACCAAGACTGCTGATG
AGTTTGTCAAAGAGTCATTGAATTATGTCACAATTGGAGGTGAAACCTGTGGCTGCCTTG
CCCATGAAATCTTGGCGGGCTTTCTGAGCCTGATCCCGGCCTGGGCCTTCTACAGCGGTG
CCTTCCAAAGGCTGCTCCTGACACACTATGTGGCATACCTGAAGCTCAACACCAAGGTCA
GGTAGCCAGGCGGTGAGGAGTCCAGCACAACCTTTTCCTCACCAGTCCCATGCTGGCTGA
AGAGGACCAGAGGAGCAGACCAGCACTTCAACCTAGTCCGCTGAAGATGGAGGGGGCTGG
GGTCACAGAGGCATAGAATACACATTTTTTGCCACTTTAAAAAAAAAAAAAAAAAAAAAA
AAAAA
Restriction Sites Please inquire |
ACCN NM_000197
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000197.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000197.1, NP_000188.1
RefSeq Size 1134 bp
RefSeq ORF 933 bp
Locus ID 3293
UniProt ID P37058
Cytogenetics 9q22.32
Protein Families Druggable Genome, Transmembrane
Protein Pathways Androgen and estrogen metabolism, Metabolic pathways
Summary This isoform of 17 beta-hydroxysteroid dehydrogenase is expressed predominantly in the testis and catalyzes the conversion of androstenedione to testosterone. It preferentially uses NADP as cofactor. Deficiency can result in male pseudohermaphroditism with gynecomastia. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_000197" in other vectors (6)
SKU Description Size Price
RC206558 HSD17B3 (Myc-DDK-tagged)-Human hydroxysteroid (17-beta) dehydrogenase 3 (HSD17B3) 10 ug
$300.00
RC206558L1 Lenti ORF clone of Human hydroxysteroid (17-beta) dehydrogenase 3 (HSD17B3), Myc-DDK-tagged 10 ug
$600.00
RC206558L2 Lenti ORF clone of Human hydroxysteroid (17-beta) dehydrogenase 3 (HSD17B3), mGFP tagged 10 ug
$600.00
RC206558L3 Lenti ORF clone of Human hydroxysteroid (17-beta) dehydrogenase 3 (HSD17B3), Myc-DDK-tagged 10 ug
$600.00
RC206558L4 Lenti ORF clone of Human hydroxysteroid (17-beta) dehydrogenase 3 (HSD17B3), mGFP tagged 10 ug
$600.00
RG206558 HSD17B3 (tGFP-tagged) - Human hydroxysteroid (17-beta) dehydrogenase 3 (HSD17B3) 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products