OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

VRK2 (NM_006296) Human Untagged Clone

Be the first to review this product
SKU
SC128263
VRK2 (untagged)-Human vaccinia related kinase 2 (VRK2), transcript variant 1
  $474.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA811397 VRK2 mouse monoclonal antibody,clone OTI2F5 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "VRK2 or NM_006296"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol VRK2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC128263 sequence for NM_006296 edited (data generated by NextGen Sequencing)
ATGCCACCAAAAAGAAATGAAAAATACAAACTTCCTATTCCATTTCCAGAAGGCAAGGTT
CTGGATGATATGGAAGGCAATCAGTGGGTACTGGGCAAGAAGATTGGCTCTGGAGGATTT
GGATTGATATATTTAGCTTTCCCCACAAATAAACCAGAGAAAGATGCAAGACATGTAGTA
AAAGTGGAATATCAAGAAAATGGCCCGTTATTTTCAGAACTTAAATTTTATCAGAGAGTT
GCAAAAAAAGACTGTATCAAAAAGTGGATAGAACGCAAACAACTTGATTATTTAGGAATT
CCTCTGTTTTATGGATCTGGTCTGACTGAATTCAAGGGAAGAAGTTACAGATTTATGGTA
ATGGAAAGACTAGGAATAGATTTACAGAAGATCTCAGGCCAGAATGGTACCTTTAAAAAG
TCAACTGTCCTGCAATTAGGTATCCGAATGTTGGATGTACTGGAATATATACATGAAAAT
GAATATGTTCATGGTGATGTAAAAGCAGCAAATCTACTTTTGGGTTACAAAAATCCAGAC
CAGGTTTATCTTGCAGATTATGGACTTTCCTACAGATATTGTCCCAATGGGAACCACAAA
CAGTATCAGGAAAATCCTAGAAAAGGCCATAATGGGACAATAGAGTTTACCAGCTTGGAT
GCCCACAAGGGAGTAGCCTTGTCCAGACGAAGTGACGTTGAGATCCTCGGCTACTGCATG
CTGCGGTGGTTGTGTGGGAAACTTCCCTGGGAACAGAACCTGAAGGACCCTGTGGCTGTG
CAGACTGCTAAAACAAATCTGTTGGACGAGCTCCCCCAGTCAGTGCTTAAATGGGCTCCT
TCTGGAAGCAGTTGCTGTGAAATAGCCCAATTTTTGGTATGTGCTCATAGTTTAGCATAT
GATGAAAAGCCAAACTATCAAGCCCTCAAGAAAATTTTGAACCCTCATGGAATACCTTTA
GGACCACTGGACTTTTCCACAAAAGGACAGAGTATAAATGTCCATACTCCAAACAGTCAA
AAAGTTGATTCACAAAAGGCTGCAACAAAGCAAGTCAACAAGGCACACAATAGGTTAATC
GAAAAAAAAGTCCACAGTGAGAGAAGCGCTGAGTCCTGTGCAACATGGAAAGTGCAGAAA
GAGGAGAAACTGATTGGATTGATGAACAATGAAGCAGCTCAGGAAAGCACAAGGAGAAGA
CAGAAATATCAAGAGTCTCAAGAACCTTTGAATGAAGTAAACAGTTTCCCACAAAAAATC
AGCTATACACAATTCCCAAACTCATTTTATGAGCCTCATCAAGATTTTACCAGTCCAGAT
ATATTCAAGAAGTCAAGATCTCCATCTTGGTATAAATACACTTCCACAGTCAGCACGGGG
ATCACAGACTTAGAAAGTTCAACTGGACTTTGGCCTACAATTTCCCAGTTTACTCTTAGT
GAAGAGACAAACGCAGATGTTTATTATTATCGCATCATCATACCTGTCCTTTTGATGTTA
GTATTTCTTGCTTTATTTTTTCTCTGA

Clone variation with respect to NM_006296.5
499 a=>g
Restriction Sites Please inquire |
ACCN NM_006296
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006296.3, NP_006287.2
RefSeq Size 2081 bp
RefSeq ORF 1527 bp
Locus ID 7444
UniProt ID Q86Y07
Cytogenetics 2p16.1
Domains pkinase, S_TKc
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Summary This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. provided by RefSeq, Jan 2014
Transcript Variant: This variant (1) encodes the longest isoform (1). Variants 1, 2, 3, and 8 encode the same isoform (1, also known as VRK2A).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006296" in other vectors (6)
SKU Description Size Price
RC206522 VRK2 (Myc-DDK-tagged)-Human vaccinia related kinase 2 (VRK2), transcript variant 1 10 ug
$473.00
RC206522L1 Lenti ORF clone of Human vaccinia related kinase 2 (VRK2), transcript variant 1, Myc-DDK-tagged 10 ug
$773.00
RC206522L2 Lenti ORF clone of Human vaccinia related kinase 2 (VRK2), transcript variant 1, mGFP tagged 10 ug
$773.00
RC206522L3 Lenti ORF clone of Human vaccinia related kinase 2 (VRK2), transcript variant 1, Myc-DDK-tagged 10 ug
$773.00
RC206522L4 Lenti ORF clone of Human vaccinia related kinase 2 (VRK2), transcript variant 1, mGFP tagged 10 ug
$773.00
RG206522 VRK2 (tGFP-tagged) - Human vaccinia related kinase 2 (VRK2), transcript variant 1 10 ug
$489.00 $673.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products