OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ATP5L (NM_006476) Human Untagged Clone

Be the first to review this product
SKU
SC127740
ATP5L (untagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G (ATP5L), nuclear gene encoding mitochondrial protein, transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA365925 ATP5MG rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ATP5L or NM_006476"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ATP5L
Synonyms ATP5JG; ATP5L
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127740 sequence for NM_006476 edited (data generated by NextGen Sequencing)
ATGGCCCAATTTGTCCGTAACCTTGTGGAGAAGACCCCGGCGCTGGTGAACGCTGCTGTG
ACTTACTCGAAGCCTCGATTGGCCACATTTTGGTACTACGCCAAGGTTGAGCTGGTTCCT
CCCACCCCTGCTGAGATCCCTAGAGCTATTCAGAGCCTGAAAAAAATAGTCAATAGTGCT
CAGACTGGTAGCTTCAAACAGCTCACAGTTAAGGAAGCTGTGCTGAATGGTTTGGTGGCC
ACTGAGGTGTTGATGTGGTTTTATGTCGGAGAGATTATAGGCAAGCGGGGCATCATTGGC
TATGATGTTTGA

Clone variation with respect to NM_006476.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006476 unedited
NNCCCCNCCCCNNNNNNNCCCCCCNNNNNNNCCCCCNNNNNCCNCGGTTCGGATTTGTAT
ACGACTTATATAGGCGGCCGCGAATTCGGCACGAGCAGCCGGCGGTTCGGGGCGACGGAC
TCTCCATTCCAGAACCATGGCCCAATTTGTCCGTAACCTTGTGGAGAAGACCCCGGCGCT
GGTGAACGCTGCTGTGACTTACTCGAAGCCTCGATTGGCCACATTTTGGTACTACGCCAA
GGTTGAGCTGGTTCCTCCCACCCCTGCTGAGATCCCTAGAGCTATTCAGAGCCTGAAAAA
AATAGTCAATAGTGCTCAGACTGGTAGCTTCAAACAGCTCACAGTTAAGGAAGCTGTGCT
GAATGGTTTGGTGGCCACTGAGGTGTTGATGTGGTTTTATGTCGGAGAGATTATAGGCAA
GCGGGGCATCATTGGCTATGATGTTTGAAGACCAATCTTTAACATCTGATTATATTTGAT
TTATTATTTGAGTGTTGTTGGACCATGTGTGATCAGACTGCTATCTGAATAAAATAAGAT
TTGTCNNANNANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCTCGACTCTAGAT
TGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTC
CCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAAT
AAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATATATATGGGGAGGGGGG
GGGGNANTANANCACAGGGCCCAANTTGGAAAAACAACCTGTAAGCCCGGCGGGGGCTTA
TTGAAAACCAAGCTGGAAGGGCAGGGGCACAATCTTGCCTCACTGCAATCTCCGCCTTCT
GGGTTCAACCGATTCTCCTGCCTCAGCTCCCGAGTTGTTTGGGATCCAGGCATGCCTGAC
CAGGCTAA
Restriction Sites NotI-NotI |
ACCN NM_006476
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006476.4, NP_006467.4
RefSeq Size 1343 bp
RefSeq ORF 312 bp
Locus ID 10632
UniProt ID O75964
Cytogenetics 11q23.3
Domains ATP-synt_G
Protein Pathways Metabolic pathways, Oxidative phosphorylation
Summary Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the g subunit of the Fo complex. Alternative splicing results in multiple transcript variants.provided by RefSeq, Jun 2010
Transcript Variant: This variant (1) represents the shorter transcript and is protein coding.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006476" in other vectors (4)
SKU Description Size Price
RC205078 ATP5L (Myc-DDK-tagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G (ATP5L), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$150.00
RC205078L3 Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G (ATP5L), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC205078L4 Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G (ATP5L), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$450.00
RG205078 ATP5L (tGFP-tagged) - Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G (ATP5L), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products