OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Major Basic Protein (PRG2) (NM_002728) Human Untagged Clone

Be the first to review this product
SKU
SC127575
PRG2 (untagged)-Human proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) (PRG2)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA813062 PRG2 mouse monoclonal antibody,clone OTI10D10 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Major Basic Protein or NM_002728"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Major Basic Protein
Synonyms BMPG; MBP; MBP1; proMBP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_002728, the custom clone sequence may differ by one or more nucleotides


ATGAAACTCCCCTTACTTCTGGCTCTTCTATTTGGGGCAGTTTCTGCTCTTCATCTAAGGTCTGAGACTT
CCACCTTTGAGACCCCTTTGGGTGCTAAGACGCTGCCTGAGGATGAGGAGACACCAGAGCAGGAGATGGA
GGAGACCCCTTGCAGGGAGCTGGAGGAAGAGGAGGAGTGGGGCTCTGGAAGTGAAGATGCCTCCAAGAAA
GATGGGGCTGTTGAGTCTATCTCAGTGCCAGATATGGTGGACAAAAACCTTACGTGTCCTGAGGAAGAGG
ACACAGTAAAAGTGGTGGGCATCCCTGGGTGCCAGACCTGCCGCTACCTCCTGGTGAGAAGTCTTCAGAC
GTTTAGTCAAGCTTGGTTTACTTGCCGGAGGTGCTACAGGGGCAACCTGGTTTCCATCCACAACTTCAAT
ATTAATTATCGAATCCAGTGTTCTGTCAGCGCGCTCAACCAGGGTCAAGTCTGGATTGGAGGCAGGATCA
CAGGCTCGGGTCGCTGCAGACGCTTTCAGTGGGTTGACGGCAGCCGCTGGAACTTTGCGTACTGGGCTGC
TCACCAGCCCTGGTCCCGCGGTGGTCACTGCGTGGCCCTGTGTACCCGAGGAGGCCACTGGCGTCGAGCC
CACTGCCTCAGAAGACTTCCTTTCATCTGTTCCTACTGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_002728 unedited
NNNTTGTTCAAATTTGTATACGACTCACTATAGGCGGCCGCGATTCGGCACGAGTAAAGA
CCCAGGAGGTCTCTGGGTGGGATAAAGCCAAGATGAAACTCCCCCTACTTCTGGCTCTTC
TATTTGGGGCAGTTTCTGCTCTTCATCTAAGGTCTGAGACTTCCACCTTTGAGACCCCTT
TGGGTGCTAAGACGCTGCCTGAGGATGAGGAGACACCAGAGCAGGAGATGGAGGAGACCC
CTTGCAGGGAGCTGGAGGAAGAGGAGGAGTGGGGCTCTGGAAGTGAAGATGCCTCCAAGA
AAGATGGGGCTGTTGAGTCTATCTCAGTGCCAGATATGGTGGACAAAAACCTTACGTGTC
CTGAGGAAGAGGACACAGTAAAAGTGGTGGGCATCCCTGGGTGCCAGACCTGCCGCTACC
TCCTGGTGAGAAGTCTTCAGACGTTTAGTCAAGCTTGGTTTACTTGCCGGAGGTGCTACA
GGGGCAACCTGGTTTCCATCCACAACTTCAATATTAATTATCGAATCCAGTGTTCTGTCA
GCGCGCTCAACCAGGGTCAAGTCTGGATTGGAGGCAGGATCACAGGCTCGGGTCGCTGCA
GACGCTTTCAGTGGGTTGACGGCAGCCGCTGGAACTTTGCGTACTGGGCTGCTCACCAGC
CCTGGTCCCGCGGTGGTCACTGCGTGGCCCTGTGTACCCGNAGAGGCTACTGGCGTCGAG
CCCACTGCCTCAGAAGACTTCCTTTCATCTGTTCCTACTGAGCTGGTCCCAGCCAGCAGT
TCAGAGCTGCCCTCTNCTGNGCAGCTGCCTCCNCTCCTCTGCTTGCCATCCCTTCCTTCA
CCTNCCCTGCATAAATGGGGTTTACTGAANAAAAAAAAAAAAACTCGAACTAGGNACGCG
NGCGGCGGGNNAATTCCCCCCCCGGGGGGGGGCCCCCC
Restriction Sites NotI-NotI |
ACCN NM_002728
Insert Size 4000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002728.4, NP_002719.3
RefSeq Size 874 bp
RefSeq ORF 669 bp
Locus ID 5553
UniProt ID P13727
Cytogenetics 11q12.1
Domains CLECT
Protein Families Secreted Protein
Protein Pathways Asthma
Summary The protein encoded by this gene is the predominant constituent of the crystalline core of the eosinophil granule. High levels of the proform of this protein are also present in placenta and pregnancy serum, where it exists as a complex with several other proteins including pregnancy-associated plasma protein A (PAPPA), angiotensinogen (AGT), and C3dg. This protein may be involved in antiparasitic defense mechanisms as a cytotoxin and helminthotoxin, and in immune hypersensitivity reactions. The encoded protein contains a peptide that displays potent antimicrobial activity against Gram-positive bacteria, Gram-negative bacteria, and fungi. It is directly implicated in epithelial cell damage, exfoliation, and bronchospasm in allergic diseases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Nov 2014
Transcript Variant: This variant (1) represents the predominant transcript and encodes the longer isoform (1). Variants 1, 3, and 4 all encode the same isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002728" in other vectors (6)
SKU Description Size Price
RC203256 PRG2 (Myc-DDK-tagged)-Human proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) (PRG2) 10 ug
$300.00
RC203256L1 Lenti ORF clone of Human proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) (PRG2), Myc-DDK-tagged 10 ug
$600.00
RC203256L2 Lenti ORF clone of Human proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) (PRG2), mGFP tagged 10 ug
$600.00
RC203256L3 Lenti ORF clone of Human proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) (PRG2), Myc-DDK-tagged 10 ug
$600.00
RC203256L4 Lenti ORF clone of Human proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) (PRG2), mGFP tagged 10 ug
$600.00
RG203256 PRG2 (tGFP-tagged) - Human proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) (PRG2) 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products