OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ID4 (NM_001546) Human Untagged Clone

Be the first to review this product
SKU
SC127564
ID4 (untagged)-Human inhibitor of DNA binding 4, dominant negative helix-loop-helix protein (ID4)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ID4 or NM_001546"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ID4
Synonyms bHLHb27; IDB4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127564 sequence for NM_001546 edited (data generated by NextGen Sequencing)
ATGAAGGCGGTGAGCCCGGTGCGCCCNTCNNGCCGCAAGGCGCCGTCGGGCTGCGGCGGC
GGGGAGCTGGCGCTGCGCTGCCTGGCCGAGCACGGCCACAGCCTGGGTGGCTCCGCAGCC
GCGGCGGCGGCGGCGGCGGCAGCGCGCTGTAAGGCGGCCGAGGCGGCGGCCGACGAGCCG
GCGCTGTGCCTGCAGTGCGATATGAACGACTGCTATAGCCGCCTGCGGAGGCTGGTGCCC
ACCATCCCGCCCAACAAGAAAGTCAGCAAAGTGGAGATCCTGCAGCACGTTATCGACTAC
ATCCTGGACCTGCAGCTGGCGCTGGAGACGCACCCGGCCCTGCTGAGGCAGCCACCACCG
CCCGCGCCGCCACACCACCCGGCCGGGACCTGTCCAGCCGCGCCGCCGCGGACCCCGCTC
ACTGCGCTCAACACCGACCCGGCCGGCGCGGTGAACAAGCAGGGCGACAGCATTCTGTGC
CGCTGA

Clone variation with respect to NM_001546.2
27 c=>n;30 g=>n;31 g=>n
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001546 unedited
TTTGTATACGACTCCTATAGGGCGGCCGCGATTCGGCACGAGGGTCAATTGTTGGGCTCG
GGAGTGTCGCGGTGCCCCGAGCGCGCCGGGCGCGGAGGCAAAGGGAGCGGAGCCGGCCGC
GGACGGGGCCCGGAGCTTGCCTGCCTCCCTCGCTCGCCCCAGCGGGTTCGCTCGCGTAGA
GCGCAGGGCGCGCGCGATGAAGGCGGTGAGCCCGGTGCGCCCCTCGGGCCGCAAGGCGCC
GTCGGGCTGCGGCGGCGGGGAGCTGGCGCTGCGCTGCCTGGCCGAGCACGGCCACAGCCT
GGGTGGCTCCGCAGCCGCGGCGGCGGCGGCGGCGGCAGCGCGCTGTAAGGCGGCCGAGGC
GGCGGCCGACGAGCCGGCGCTGTGCCTGCAGTGCGATATGAACGACTGCTATAGCCGCCT
GCGGAGGCTGGTGCCCACCATCCCGCCCAACAAGAAAGTCAGCAAAGTGGAGATCCTGCA
GCACGTTATCGACTACATCCTGGACCTGCAGCTGGCGCTGGAGACGCACCCGGCCCTGCT
GAGGCAGCCACCACCGCCCGCGCCGNCACACCACCCGGCCGGGACCTGTCCAGCCGCGCC
GCCGCGGACCCCGCTCACTGCGCTCAACACCGACCCGGCCGGGCGCGGTGAACAAGCAGG
GCGACAGCATTCTGTGCCGCTGAGCCGCGCTGTCCANGTGTGCGGNCGCCTGAGCCCGAG
CCAGGAGCACTAGAGAGGGGAGGGGGAGAGCAGNAGTTANAGAAAAAAAGCCACCGGAGG
GAAAGAAAAAACATCGGCCAACCTAGAAACGTTTTCATTCGTCATTCCCAGAGAGAGAGA
GGGAAAGAAAATTCCACTTTCATTCTTTCTTTGCACGTTCATAAACATTCTACATACGTA
TTCTCCTTTTGGCCTCTCCATT
Restriction Sites NotI-NotI |
ACCN NM_001546
Insert Size 3100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001546.2, NP_001537.1
RefSeq Size 2389 bp
RefSeq ORF 486 bp
Locus ID 3400
UniProt ID P47928
Cytogenetics 6p22.3
Domains HLH
Protein Families ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways TGF-beta signaling pathway
Summary This gene encodes a member of the inhibitor of DNA binding (ID) protein family. The encoded protein lacks DNA binding ability, and instead regulates gene expression through binding to and inhibiting basic helix-loop-helix transcription factors. This protein has been implicated in the regulation of diverse cellular processes that play a role in development and tumorigenesis. provided by RefSeq, Aug 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001546" in other vectors (6)
SKU Description Size Price
RC204170 ID4 (Myc-DDK-tagged)-Human inhibitor of DNA binding 4, dominant negative helix-loop-helix protein (ID4) 10 ug
$150.00
RC204170L1 Lenti ORF clone of Human inhibitor of DNA binding 4, dominant negative helix-loop-helix protein (ID4), Myc-DDK-tagged 10 ug
$450.00
RC204170L2 Lenti ORF clone of Human inhibitor of DNA binding 4, dominant negative helix-loop-helix protein (ID4), mGFP tagged 10 ug
$450.00
RC204170L3 Lenti ORF clone of Human inhibitor of DNA binding 4, dominant negative helix-loop-helix protein (ID4), Myc-DDK-tagged 10 ug
$450.00
RC204170L4 Lenti ORF clone of Human inhibitor of DNA binding 4, dominant negative helix-loop-helix protein (ID4), mGFP tagged 10 ug
$450.00
RG204170 ID4 (tGFP-tagged) - Human inhibitor of DNA binding 4, dominant negative helix-loop-helix protein (ID4) 10 ug
$350.00

file-alt Citations

miRNA-342 regulates CEACAM1-induced lumen formation in a 3D model of mammary gland morphogenesis
Weng, Nguyen, Shively
J. Biol. Chem. (2016)
AI Summary: In this study, the pCMV6-ID4 plasmid from OriGene Technologies was used to investigate the role of ID4 in miRNA-342-regulated lumen formation in mammary gland morphogenesis.
Snippet: The LightSwitch 3'UTR Reporter GoClone for ID4 and miRNA inhibitors and control were from Active Motif (Carlsbad, CA). pCMV6-ID4 plasmid was obtained from OriGene Technologies, Inc (Rockville, MD). miRNA microarray. ... Cite SaveSaving
Induction of lumen formation in a 3D model of mammary morphogenesis by transcriptional regulator ID4: Role of CaMK2D in the epigenetic regulation of ID4 gene expression
Nguyen, Shively
J. Biol. Chem. (2016)
AI Summary: OriGene's pCMV6 plasmids for CaMK2D and ID4 were used to manipulate the expression of these genes in MCF7 cells, enabling the study of their roles in lumen formation and epigenetic regulation in breast cancer models.
Snippet: 5-aza-2'-deoxycytidine (DAC) and trichostatin A (TSA) were from Sigma- Aldrich (St. Louis, MO). CaMKII-specific inhibitor KN-93 and inactive analog KN-92 were from Calbiochem. pCMV6 plasmids for CaMK2D and ID4 were from OriGene Technologies, Inc (Rockville ... Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products