OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

LIN7C (NM_018362) Human Untagged Clone

Be the first to review this product
SKU
SC127489
LIN7C (untagged)-Human lin-7 homolog C (C. elegans) (LIN7C)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA356244 LIN7C Antibody - N-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "LIN7C or NM_018362"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LIN7C
Synonyms LIN-7-C; LIN-7C; MALS-3; MALS3; VELI3
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_018362, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGCTAGGGGAACCCGTGCGGCTGGAGAGAGATATTTGTAGAGCAATTGAATTATTGGAAAAAC
TACAAAGGAGTGGAGAAGTACCACCACAGAAACTTCAGGCTTTGCAAAGAGTCCTTCAAAGTGAATTCTG
CAATGCTGTGAGAGAGGTATATGAACATGTCTATGAGACTGTGGACATCAGTAGCAGTCCTGAAGTGAGA
GCGAACGCTACTGCAAAGGCTACTGTTGCTGCATTTGCTGCCAGTGAAGGACATTCTCATCCTCGAGTTG
TTGAGCTACCAAAAACAGAAGAGGGCCTTGGATTCAATATTATGGGAGGCAAAGAACAAAACTCTCCAAT
CTATATATCCCGAATAATTCCAGGTGGAATTGCTGATAGACATGGGGGCCTCAAACGTGGAGATCAACTC
CTCTCTGTTAATGGAGTGAGTGTTGAAGGAGAACATCATGAAAAAGCTGTAGAACTGCTGAAAGCCGCAC
AAGGAAAGGTTAAATTAGTGGTACGATACACACCCAAAGTCTTAGAAGAAATGGAGTCGCGCTTTGAAAA
AATGAGATCAGCAAAACGCAGGCAACAGACCTAA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_018362 unedited
CCGCGAATTCGGCACCAGGATGGCGGCGCTAGGGGAACCCGTGCGGCTGGAGAGAGATAT
TTGTAGAGCAATTGAATTATTGGAAAAACTACAAAGGAGTGGAGAAGTACCACCACAGAA
ACTTCAGGCTTTGCAAAGAGTCCTTCAAAGTGAATTCTGCAATGCTGTGAGAGAGGTATA
TGAACATGTCTATGAGACTGTGGACATCAGTAGCAGTCCTGAAGTGAGAGCGAACGCTAC
TGCAAAGGCTACTGTTGCTGCATTTGCTGCCAGTGAAGGACATTCTCATCCTCGAGTTGT
TGAGCTACCAAAAACAGAAGAGGGCCTTGGATTCAATATTATGGGAGGCAAAGAACAAAA
CTCTCCAATCTATATATCCCGAATAATTCCAGGTGGAATTGCTGATAGACATGGGGGCCT
CAAACGTGGAGATCAACTCCTCTCTGTTAATGGAGTGAGTGTTGAAGGAGAACATCATGA
AAAAGCTGTAGAACTGCTGAAAGCCGCACAAGGAAAGGTTAAATTAGTGGTACGATACAC
ACCCAAAGTCTTAGAAGAAATGGAGTCGCGCTTTGAAAAATGAGATCAGCAAAACGCAGG
CAACAGACCTAATACATTTCAAAACTTGATATTTCATTTTGCGTTTTAGCTAGAGAAGTT
TTCCTTGTGACTTACTAATGGCTGCAATGCCAATGATTGNTAGAAAACAACAAATTTATC
ATGAAATTT
Restriction Sites NotI-NotI |
ACCN NM_018362
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018362.2, NP_060832.1
RefSeq Size 4729 bp
RefSeq ORF 594 bp
Locus ID 55327
UniProt ID Q9NUP9
Cytogenetics 11p14.1
Domains L27, PDZ
Protein Families Druggable Genome
Summary Plays a role in establishing and maintaining the asymmetric distribution of channels and receptors at the plasma membrane of polarized cells. Forms membrane-associated multiprotein complexes that may regulate delivery and recycling of proteins to the correct membrane domains. The tripartite complex composed of LIN7 (LIN7A, LIN7B or LIN7C), CASK and APBA1 may have the potential to couple synaptic vesicle exocytosis to cell adhesion in brain. Ensures the proper localization of GRIN2B (subunit 2B of the NMDA receptor) to neuronal postsynaptic density and may function in localizing synaptic vesicles at synapses where it is recruited by beta-catenin and cadherin. Required to localize Kir2 channels, GABA transporter (SLC6A12) and EGFR/ERBB1, ERBB2, ERBB3 and ERBB4 to the basolateral membrane of epithelial cells.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_018362" in other vectors (6)
SKU Description Size Price
RC208758 LIN7C (Myc-DDK-tagged)-Human lin-7 homolog C (C. elegans) (LIN7C) 10 ug
$300.00
RC208758L1 Lenti ORF clone of Human lin-7 homolog C (C. elegans) (LIN7C), Myc-DDK-tagged 10 ug
$600.00
RC208758L2 Lenti ORF clone of Human lin-7 homolog C (C. elegans) (LIN7C), mGFP tagged 10 ug
$600.00
RC208758L3 Lenti ORF clone of Human lin-7 homolog C (C. elegans) (LIN7C), Myc-DDK-tagged 10 ug
$600.00
RC208758L4 Lenti ORF clone of Human lin-7 homolog C (C. elegans) (LIN7C), mGFP tagged 10 ug
$600.00
RG208758 LIN7C (tGFP-tagged) - Human lin-7 homolog C (C. elegans) (LIN7C) 10 ug
$500.00

file-alt Citations

The avian influenza virus NS1 ESEV PDZ binding motif associates with Dlg1 and Scribble to disrupt cellular tight junctions
Golebiewski, Liu, Javier et al
J. Virol. (2011) 85 (20), 10639-48 DOI: 10.1128/JVI.05070-11
Cited by 23
AI Summary: OriGene contributed the Lin7C coding region, which was used to construct a mammalian expression vector to study the interaction between influenza virus NS1 protein and cellular PDZ proteins in the disruption of tight junctions.
Snippet: Dlg1-Δ3PDZ (12). To construct a mammalian expression vector for Lin7C, PCR was used to insert the coding region of Lin7C (Origene) into a histidine-tagged expression vector (pET46;Novagen). Expression and purification
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products