OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RMI2 (NM_152308) Human Untagged Clone

Be the first to review this product
SKU
SC127207
RMI2 (untagged)-Human chromosome 16 open reading frame 75 (C16orf75)
  $225.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA890146 Rabbit Polyclonal anti-RMI2 Antibody
100 ul
$407.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RMI2 or NM_152308"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RMI2
Synonyms BLAP18; C16orf75
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127207 sequence for NM_152308 edited (data generated by NextGen Sequencing)
ATGGCGGCGGCTGCGGACTCGTTCTCAGGCGGCCCCGCGGGGGTGCGGCTTCCGAGGTCG
CCGCCACTCAAGGTGCTGGCGGAGCAGCTGCGGCGCGACGCGGAGGGCGGCCCGGGCGCG
TGGCGGCTGTCACGGGCGGCGGCGGGCCGCGGGCCGCTGGACCTGGCAGCCGTGTGGATG
CAGGGCAGGGTAGTGATGGCGGACCGCGGCGAGGCTCGGCTGAGGGACCCGAGCGGGGAC
TTCTCGGTCCGCGGCCTGGAGCGGGTGCCGCGCGGGCGGCCCTGTCTAGTCCCAGGAAAG
TATGTGATGGTGATGGGAGTGGTTCAGGCCTGCAGCCCTGAGCCCTGCCTGCAGGCTGTG
AAGATGACCGACCTTTCTGATAATCCCATCCATGAAAGTATGTGGGAACTGGAGGTAGAA
GATTTACACAGGAATATTCCTTAG

Clone variation with respect to NM_152308.1
168 g=>a;369 a=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_152308 unedited
TTTTGGTCTACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGCGAGGCGGAATG
GCGGCGGCTGCGGACTCGTTCTCAGGCGGCCCCGCGGGGGTGCGGCTTCCGAGGTCGCCG
CCACTCAAGGTGCTGGCGGAGCAGCTGCGGCGCGACGCGGAGGGCGGCCCGGGCGCGTGG
CGGCTGTCACGGGCGGCGGCGGGCCGCGGGCCGCTGGACCTGGCAGCCGTGTGGATGCAG
GGCAGGGTAGTGATGGCGGACCGCGGCGAGGCTCGGCTGAGGGACCCGAGCGGGGACTTC
TCGGTCCGCGGCCTGGAGCGGGTGCCGCGCGGGCGGCCCTGTCTAGTCCCAGGAAAGTAT
GTGATGGTGATGGGAGTGGTTCAGGCCTGCAGCCCTGAGCCCTGCCTGCAGGCTGTGAAG
ATGACCGACCTTTCTGATAATCCCATCCATGAAAGTATGTGGGAACTGGAGGTAGAAGAT
TTACACAGGAATATTCCTTAGAGTATGTTGGAACTGTCGTTAAAAACAACCAAAATCCCG
AAACTATTTAGAAGCTTATAATGATGTGGATTTCATGGATACTTTTCAATGCGTATTTTT
CAAATGCTTCTCAGAGAGCCTTGCTTTGGTTGACCAAGGAGTCCGGATGTANGAATGTTT
AAATCCTCGGATACTTCAGTGACACAGCCTCTGCTGCCCCTTGCNTTTGCCTGTGTTGCT
GATGAAAAACAGATGCTTGTGTTTCATTTTCCTTCCTGGNTTGNNGTGTGTAAATTCTCT
CTCTCTCTCTCAGACCCAGAAGTCTCATGTTGCCATTTCCAAATTTATGAGTGATGATAC
TTTTCCATTACTGCTGCGTCCCTGTTTTACATGCAAAATTAAGTACGGCATTGCCATGG
Restriction Sites NotI-NotI |
ACCN NM_152308
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152308.1, NP_689521.1
RefSeq Size 1462 bp
RefSeq ORF 444 bp
Locus ID 116028
UniProt ID Q96E14
Cytogenetics 16p13.13
Summary RMI2 is a component of the BLM (RECQL3; MIM 604610) complex, which plays a role in homologous recombination-dependent DNA repair and is essential for genome stability (Xu et al., 2008 PubMed 18923082).supplied by OMIM, Nov 2008
Transcript Variant: This variant (1) represents the longer transcript and encodes the protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_152308" in other vectors (6)
SKU Description Size Price
RC205111 RMI2 (Myc-DDK-tagged)-Human chromosome 16 open reading frame 75 (C16orf75) 10 ug
$225.00
RC205111L1 Lenti ORF clone of Human chromosome 16 open reading frame 75 (C16orf75), Myc-DDK-tagged 10 ug
$525.00
RC205111L2 Lenti ORF clone of Human chromosome 16 open reading frame 75 (C16orf75), mGFP tagged 10 ug
$525.00
RC205111L3 Lenti ORF clone of Human chromosome 16 open reading frame 75 (C16orf75), Myc-DDK-tagged 10 ug
$525.00
RC205111L4 Lenti ORF clone of Human chromosome 16 open reading frame 75 (C16orf75), mGFP tagged 10 ug
$525.00
RG205111 RMI2 (tGFP-tagged) - Human chromosome 16 open reading frame 75 (C16orf75) 10 ug
$425.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products